ID: 935593638

View in Genome Browser
Species Human (GRCh38)
Location 2:104863401-104863423
Sequence CTTTCTGCAGGGCTTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935593634_935593638 -4 Left 935593634 2:104863382-104863404 CCAGAGGTTCTGGCGATAACTTT No data
Right 935593638 2:104863401-104863423 CTTTCTGCAGGGCTTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935593638 Original CRISPR CTTTCTGCAGGGCTTGTGGA AGG Intergenic
No off target data available for this crispr