ID: 935593638 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:104863401-104863423 |
| Sequence | CTTTCTGCAGGGCTTGTGGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 935593634_935593638 | -4 | Left | 935593634 | 2:104863382-104863404 | CCAGAGGTTCTGGCGATAACTTT | No data | ||
| Right | 935593638 | 2:104863401-104863423 | CTTTCTGCAGGGCTTGTGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 935593638 | Original CRISPR | CTTTCTGCAGGGCTTGTGGA AGG | Intergenic | ||
| No off target data available for this crispr | |||||