ID: 935593996

View in Genome Browser
Species Human (GRCh38)
Location 2:104865716-104865738
Sequence AGGGAAACTTCCAGGTGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935593986_935593996 8 Left 935593986 2:104865685-104865707 CCCACCACGCTCATTGTACCCAG No data
Right 935593996 2:104865716-104865738 AGGGAAACTTCCAGGTGTGAGGG No data
935593992_935593996 -10 Left 935593992 2:104865703-104865725 CCCAGGTTTAGACAGGGAAACTT No data
Right 935593996 2:104865716-104865738 AGGGAAACTTCCAGGTGTGAGGG No data
935593987_935593996 7 Left 935593987 2:104865686-104865708 CCACCACGCTCATTGTACCCAGG No data
Right 935593996 2:104865716-104865738 AGGGAAACTTCCAGGTGTGAGGG No data
935593989_935593996 4 Left 935593989 2:104865689-104865711 CCACGCTCATTGTACCCAGGTTT No data
Right 935593996 2:104865716-104865738 AGGGAAACTTCCAGGTGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935593996 Original CRISPR AGGGAAACTTCCAGGTGTGA GGG Intergenic
No off target data available for this crispr