ID: 935595286 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:104873232-104873254 |
| Sequence | AGCTCTCCGACCCGCACGTC CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 935595280_935595286 | 19 | Left | 935595280 | 2:104873190-104873212 | CCGGTAAGTAAGGGCAGAGAAAG | No data | ||
| Right | 935595286 | 2:104873232-104873254 | AGCTCTCCGACCCGCACGTCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 935595286 | Original CRISPR | AGCTCTCCGACCCGCACGTC CGG | Intergenic | ||