ID: 935595286

View in Genome Browser
Species Human (GRCh38)
Location 2:104873232-104873254
Sequence AGCTCTCCGACCCGCACGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935595280_935595286 19 Left 935595280 2:104873190-104873212 CCGGTAAGTAAGGGCAGAGAAAG No data
Right 935595286 2:104873232-104873254 AGCTCTCCGACCCGCACGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935595286 Original CRISPR AGCTCTCCGACCCGCACGTC CGG Intergenic