ID: 935595287

View in Genome Browser
Species Human (GRCh38)
Location 2:104873233-104873255
Sequence GCTCTCCGACCCGCACGTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935595280_935595287 20 Left 935595280 2:104873190-104873212 CCGGTAAGTAAGGGCAGAGAAAG No data
Right 935595287 2:104873233-104873255 GCTCTCCGACCCGCACGTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935595287 Original CRISPR GCTCTCCGACCCGCACGTCC GGG Intergenic
No off target data available for this crispr