ID: 935595489

View in Genome Browser
Species Human (GRCh38)
Location 2:104874159-104874181
Sequence CTTCCTCCCAGGAGACCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935595489_935595501 25 Left 935595489 2:104874159-104874181 CCTGCGGGTCTCCTGGGAGGAAG No data
Right 935595501 2:104874207-104874229 GGGGATTGGGAGCTGCTGTTTGG No data
935595489_935595499 12 Left 935595489 2:104874159-104874181 CCTGCGGGTCTCCTGGGAGGAAG No data
Right 935595499 2:104874194-104874216 GAAGAACTGTCCTGGGGATTGGG No data
935595489_935595502 28 Left 935595489 2:104874159-104874181 CCTGCGGGTCTCCTGGGAGGAAG No data
Right 935595502 2:104874210-104874232 GATTGGGAGCTGCTGTTTGGAGG No data
935595489_935595496 6 Left 935595489 2:104874159-104874181 CCTGCGGGTCTCCTGGGAGGAAG No data
Right 935595496 2:104874188-104874210 TGTCCTGAAGAACTGTCCTGGGG No data
935595489_935595495 5 Left 935595489 2:104874159-104874181 CCTGCGGGTCTCCTGGGAGGAAG No data
Right 935595495 2:104874187-104874209 GTGTCCTGAAGAACTGTCCTGGG No data
935595489_935595494 4 Left 935595489 2:104874159-104874181 CCTGCGGGTCTCCTGGGAGGAAG No data
Right 935595494 2:104874186-104874208 AGTGTCCTGAAGAACTGTCCTGG No data
935595489_935595498 11 Left 935595489 2:104874159-104874181 CCTGCGGGTCTCCTGGGAGGAAG No data
Right 935595498 2:104874193-104874215 TGAAGAACTGTCCTGGGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935595489 Original CRISPR CTTCCTCCCAGGAGACCCGC AGG (reversed) Intergenic
No off target data available for this crispr