ID: 935597228

View in Genome Browser
Species Human (GRCh38)
Location 2:104888715-104888737
Sequence CTGAGAGTGGGGAAGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935597228_935597235 0 Left 935597228 2:104888715-104888737 CCCACTTCCTTCCCCACTCTCAG No data
Right 935597235 2:104888738-104888760 GAGAGTCACAGTAACCAATTTGG No data
935597228_935597236 1 Left 935597228 2:104888715-104888737 CCCACTTCCTTCCCCACTCTCAG No data
Right 935597236 2:104888739-104888761 AGAGTCACAGTAACCAATTTGGG No data
935597228_935597239 29 Left 935597228 2:104888715-104888737 CCCACTTCCTTCCCCACTCTCAG No data
Right 935597239 2:104888767-104888789 TATTTAACACCTGCAAATCTTGG No data
935597228_935597237 2 Left 935597228 2:104888715-104888737 CCCACTTCCTTCCCCACTCTCAG No data
Right 935597237 2:104888740-104888762 GAGTCACAGTAACCAATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935597228 Original CRISPR CTGAGAGTGGGGAAGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr