ID: 935599421

View in Genome Browser
Species Human (GRCh38)
Location 2:104907339-104907361
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935599421_935599431 27 Left 935599421 2:104907339-104907361 CCCATCCCCTTATTCTCCTGAAT No data
Right 935599431 2:104907389-104907411 AAAGCCTTGTGTATCTACTTGGG No data
935599421_935599430 26 Left 935599421 2:104907339-104907361 CCCATCCCCTTATTCTCCTGAAT No data
Right 935599430 2:104907388-104907410 AAAAGCCTTGTGTATCTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935599421 Original CRISPR ATTCAGGAGAATAAGGGGAT GGG (reversed) Intergenic
No off target data available for this crispr