ID: 935599425

View in Genome Browser
Species Human (GRCh38)
Location 2:104907346-104907368
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935599425_935599430 19 Left 935599425 2:104907346-104907368 CCTTATTCTCCTGAATTCCTTCA No data
Right 935599430 2:104907388-104907410 AAAAGCCTTGTGTATCTACTTGG No data
935599425_935599431 20 Left 935599425 2:104907346-104907368 CCTTATTCTCCTGAATTCCTTCA No data
Right 935599431 2:104907389-104907411 AAAGCCTTGTGTATCTACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935599425 Original CRISPR TGAAGGAATTCAGGAGAATA AGG (reversed) Intergenic