ID: 935599431

View in Genome Browser
Species Human (GRCh38)
Location 2:104907389-104907411
Sequence AAAGCCTTGTGTATCTACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935599424_935599431 21 Left 935599424 2:104907345-104907367 CCCTTATTCTCCTGAATTCCTTC No data
Right 935599431 2:104907389-104907411 AAAGCCTTGTGTATCTACTTGGG No data
935599426_935599431 11 Left 935599426 2:104907355-104907377 CCTGAATTCCTTCATAGCACTTG No data
Right 935599431 2:104907389-104907411 AAAGCCTTGTGTATCTACTTGGG No data
935599425_935599431 20 Left 935599425 2:104907346-104907368 CCTTATTCTCCTGAATTCCTTCA No data
Right 935599431 2:104907389-104907411 AAAGCCTTGTGTATCTACTTGGG No data
935599427_935599431 3 Left 935599427 2:104907363-104907385 CCTTCATAGCACTTGCCACTGCC No data
Right 935599431 2:104907389-104907411 AAAGCCTTGTGTATCTACTTGGG No data
935599422_935599431 26 Left 935599422 2:104907340-104907362 CCATCCCCTTATTCTCCTGAATT No data
Right 935599431 2:104907389-104907411 AAAGCCTTGTGTATCTACTTGGG No data
935599423_935599431 22 Left 935599423 2:104907344-104907366 CCCCTTATTCTCCTGAATTCCTT No data
Right 935599431 2:104907389-104907411 AAAGCCTTGTGTATCTACTTGGG No data
935599421_935599431 27 Left 935599421 2:104907339-104907361 CCCATCCCCTTATTCTCCTGAAT No data
Right 935599431 2:104907389-104907411 AAAGCCTTGTGTATCTACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935599431 Original CRISPR AAAGCCTTGTGTATCTACTT GGG Intergenic
No off target data available for this crispr