ID: 935612257

View in Genome Browser
Species Human (GRCh38)
Location 2:105037895-105037917
Sequence GTGGAGTCGGATACGCCCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 20}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935612250_935612257 4 Left 935612250 2:105037868-105037890 CCTTCTTGAGGTCGACACCGAGC 0: 1
1: 0
2: 0
3: 0
4: 22
Right 935612257 2:105037895-105037917 GTGGAGTCGGATACGCCCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 20
935612245_935612257 29 Left 935612245 2:105037843-105037865 CCGAGAAAAACGACCCACCAGCG 0: 1
1: 0
2: 0
3: 2
4: 47
Right 935612257 2:105037895-105037917 GTGGAGTCGGATACGCCCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 20
935612248_935612257 15 Left 935612248 2:105037857-105037879 CCACCAGCGATCCTTCTTGAGGT 0: 1
1: 0
2: 1
3: 3
4: 88
Right 935612257 2:105037895-105037917 GTGGAGTCGGATACGCCCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 20
935612249_935612257 12 Left 935612249 2:105037860-105037882 CCAGCGATCCTTCTTGAGGTCGA 0: 1
1: 0
2: 0
3: 0
4: 23
Right 935612257 2:105037895-105037917 GTGGAGTCGGATACGCCCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 20
935612246_935612257 16 Left 935612246 2:105037856-105037878 CCCACCAGCGATCCTTCTTGAGG 0: 1
1: 0
2: 1
3: 4
4: 72
Right 935612257 2:105037895-105037917 GTGGAGTCGGATACGCCCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935612257 Original CRISPR GTGGAGTCGGATACGCCCCG CGG Intergenic