ID: 935614690

View in Genome Browser
Species Human (GRCh38)
Location 2:105065043-105065065
Sequence CTGTCTCCACTGATAGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935614686_935614690 30 Left 935614686 2:105064990-105065012 CCGTTTTATGTGTACTATTACAG 0: 1
1: 0
2: 0
3: 15
4: 234
Right 935614690 2:105065043-105065065 CTGTCTCCACTGATAGAATGAGG 0: 1
1: 0
2: 1
3: 30
4: 202
935614688_935614690 3 Left 935614688 2:105065017-105065039 CCCTATATTTGAGACTATGTATA 0: 1
1: 0
2: 2
3: 22
4: 352
Right 935614690 2:105065043-105065065 CTGTCTCCACTGATAGAATGAGG 0: 1
1: 0
2: 1
3: 30
4: 202
935614687_935614690 4 Left 935614687 2:105065016-105065038 CCCCTATATTTGAGACTATGTAT 0: 1
1: 0
2: 1
3: 21
4: 249
Right 935614690 2:105065043-105065065 CTGTCTCCACTGATAGAATGAGG 0: 1
1: 0
2: 1
3: 30
4: 202
935614689_935614690 2 Left 935614689 2:105065018-105065040 CCTATATTTGAGACTATGTATAC 0: 1
1: 0
2: 2
3: 9
4: 224
Right 935614690 2:105065043-105065065 CTGTCTCCACTGATAGAATGAGG 0: 1
1: 0
2: 1
3: 30
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935614690 Original CRISPR CTGTCTCCACTGATAGAATG AGG Intronic
902576678 1:17382317-17382339 CTTTCTCCACTTGTAAAATGGGG + Intronic
902930264 1:19726167-19726189 CTCTCTCCCCTGCTAGAATGTGG - Intronic
903006072 1:20299793-20299815 CTGTCTCCACTCAAAACATGGGG + Intronic
903648250 1:24907452-24907474 CTGTCTCCACTGAGACTCTGGGG - Intronic
904120831 1:28196739-28196761 CTGCCTCCTCTGGTAAAATGAGG - Intergenic
905390432 1:37632966-37632988 CACTCTACACAGATAGAATGGGG + Intronic
905530454 1:38674613-38674635 CTGTCCCCACTAATAAAATGTGG - Intergenic
905540498 1:38756599-38756621 TTGTTTCCTCTGATAGTATGGGG - Intergenic
907623446 1:56005920-56005942 CTCTTTCCACTGATGGAAGGAGG + Intergenic
909476792 1:76089931-76089953 GTGTCTCCATTTATAAAATGGGG - Intronic
911087820 1:93993826-93993848 CTGTCTCCAGTTATAAAGTGTGG + Intronic
912615716 1:111097631-111097653 CTGTCTTGAATGTTAGAATGTGG + Intergenic
913717971 1:121557816-121557838 CTGTCTGCTGTGACAGAATGTGG + Intergenic
914424084 1:147558586-147558608 ATGTCTCCACAGATAGAACCAGG - Intronic
917481421 1:175415268-175415290 CTGCCTCCACTGACACAATGGGG - Intronic
920723877 1:208415632-208415654 CTGTCTCCTCTCTTAGATTGTGG + Intergenic
921593755 1:217032935-217032957 CTATCTCCACTGATAGCCTTCGG + Intronic
922182136 1:223243590-223243612 CTGTCTCCACTACCAGCATGTGG + Intronic
922354782 1:224765400-224765422 CTGTTTCCACTGCTGGAAGGAGG + Intergenic
923286114 1:232497436-232497458 CTGTCCCCACTGACAGGCTGTGG - Intronic
923382693 1:233437506-233437528 ATGTTTACAATGATAGAATGGGG + Intergenic
923482244 1:234396536-234396558 TTGTCTCCTCTGTAAGAATGTGG + Intronic
1062991898 10:1827128-1827150 CTGCCTTGACTGATAGAAGGTGG + Intergenic
1063093246 10:2886620-2886642 GTGTCTCTACCCATAGAATGAGG - Intergenic
1063616818 10:7607473-7607495 CTGTCTCTACAGAAAGAAAGAGG + Intronic
1063649245 10:7917142-7917164 CTGTCTCCCCAGCTAAAATGTGG - Intronic
1063901095 10:10733163-10733185 TTGTCTACACAGGTAGAATGTGG - Intergenic
1065828916 10:29596917-29596939 CTGTCTCCATTGCTACGATGAGG + Intronic
1066148442 10:32587921-32587943 CTGTCAACACTGCTACAATGGGG - Intronic
1071601435 10:86960427-86960449 CTGTTTTCACTTATAAAATGGGG - Intronic
1073786389 10:106894880-106894902 CTTTCTCAACTGACGGAATGGGG + Intronic
1074735383 10:116425822-116425844 CTGGCTCGACTCATGGAATGAGG + Intergenic
1074926277 10:118075438-118075460 CTATCTCCACTGTTAGAACCTGG + Intergenic
1075941925 10:126397120-126397142 GTGTATCCGCTGATAGCATGAGG + Intergenic
1076174936 10:128361060-128361082 CTGTCTCCACTGGAGAAATGTGG + Intergenic
1078004877 11:7525103-7525125 CTGCCTGCCATGATAGAATGAGG - Intronic
1080973681 11:37308830-37308852 TGGTCTCCACTGATATCATGGGG + Intergenic
1081623653 11:44634168-44634190 CTGTCTCCCCTACTAGAATGTGG + Intergenic
1083251184 11:61468322-61468344 CTGTCTCCAATGATCGCATGGGG + Intronic
1083846993 11:65341209-65341231 CTGTCTCCCCTTCTAGACTGAGG - Intronic
1084540109 11:69781182-69781204 CTCTCACCACTGAGGGAATGTGG + Intergenic
1085179243 11:74519773-74519795 ATGTCACCTCTGATAGAATTGGG + Intronic
1086034397 11:82399076-82399098 ATATCTCCACTGATAGTAGGTGG - Intergenic
1086078045 11:82875653-82875675 TTGTCTCCTCTGGTAGACTGTGG - Intronic
1086601419 11:88638488-88638510 CTGTCTTCATTGATTGAATTAGG + Intronic
1087928027 11:103942885-103942907 CTGTCTCCACTGTAAAATTGGGG + Intronic
1089028600 11:115298351-115298373 CTGGCTCTAAGGATAGAATGAGG + Intronic
1089525937 11:119096531-119096553 TTGTCTCCATTGAGAGCATGTGG + Exonic
1090051128 11:123380836-123380858 CTGTCTCCAGTCCCAGAATGAGG - Intergenic
1092026870 12:5248081-5248103 CTCCCTCCACTAATAGAATCAGG + Intergenic
1094043053 12:26137493-26137515 GTGTCCGCACTTATAGAATGAGG + Intronic
1094561679 12:31560434-31560456 CTATCTCCACTGCTACTATGTGG + Intronic
1095137716 12:38626220-38626242 CTGTGTCCATTAATAGCATGTGG + Intergenic
1098016385 12:66109016-66109038 TTGTTTCCATTGATAGAATGGGG - Intergenic
1098069231 12:66654061-66654083 CTGTGACCACTGATTGATTGGGG + Intronic
1101277730 12:103220730-103220752 TTGTCACCACTGATAGAGAGAGG - Intergenic
1102620836 12:114193293-114193315 CTGTCTGCACTCATAGCATGGGG + Intergenic
1103018752 12:117516671-117516693 ATTTCTCCACATATAGAATGGGG - Intronic
1103413618 12:120729794-120729816 CTGTCACCACTGATAAAATGGGG + Intronic
1105907000 13:24821980-24822002 CTGTCTCTAGTGAGAGAAAGGGG + Intronic
1105943876 13:25173533-25173555 CTTTCTCCACTGGGAGAAAGTGG + Intergenic
1107743019 13:43473806-43473828 CTGTCTCCATTCAGAGAAAGAGG - Intronic
1107850943 13:44573280-44573302 CTGTCACCACTGATAGTCTGAGG + Exonic
1108533023 13:51345176-51345198 GTTTCTCCATTTATAGAATGGGG - Intronic
1109589548 13:64460144-64460166 TTGTCTGCATTGAGAGAATGTGG + Intergenic
1111274088 13:85924990-85925012 CTGTCTCCAAGGCTGGAATGTGG - Intergenic
1112840344 13:103568504-103568526 CTGATACCAATGATAGAATGGGG - Intergenic
1114296441 14:21333778-21333800 CTGTCTCAACTGAAAGAGTACGG - Intronic
1115307741 14:31949852-31949874 CTGCCTCCACTGAGAGGGTGTGG + Intronic
1124700324 15:31906944-31906966 CTGGCTCCCCTGCTAGAGTGAGG - Intergenic
1124806303 15:32886791-32886813 CCCTCTCCACTGGTAGAATTAGG - Intronic
1126618223 15:50608547-50608569 CTGTCTCCACTGATGAAAATAGG - Intronic
1127066511 15:55245217-55245239 CTGTCTCCACTTATGGAAATGGG - Intronic
1130710628 15:86277571-86277593 CTGTCTCCTGTGGTTGAATGTGG + Intronic
1130838010 15:87670912-87670934 CTGTTTCCAGTGACAGAAAGAGG - Intergenic
1131591124 15:93749252-93749274 CTGTCTCCAATGATCTAATATGG - Intergenic
1132294208 15:100723480-100723502 CACTCTACTCTGATAGAATGAGG - Intergenic
1134747042 16:16596446-16596468 CTGTCTCTTCTGCCAGAATGTGG - Intergenic
1134863171 16:17579045-17579067 CTGTCTCCACTGATATCCAGAGG - Intergenic
1134998434 16:18757214-18757236 CTGTCTCTTCTGCCAGAATGTGG + Intergenic
1137463907 16:48690742-48690764 CTGTCTTCACTGCTAGACTGTGG + Intergenic
1137501080 16:49012252-49012274 CTGTCTCCATTGATAGAGTTTGG - Intergenic
1138584719 16:57962411-57962433 CTGTTTCCAGCCATAGAATGGGG - Intronic
1139049531 16:63106943-63106965 CTGTTTCAACTAATAGAATACGG - Intergenic
1140857239 16:78988857-78988879 GTTTCTCCACTGATCGATTGGGG - Intronic
1142145502 16:88491298-88491320 TGGTCTCCACTGATAGAGTGTGG - Intronic
1142310435 16:89309329-89309351 CTGTCTCCACTGGTAGGTTTTGG - Intronic
1142625586 17:1189799-1189821 CTGTCTCTCCTGCTAGACTGAGG + Intronic
1144770555 17:17757172-17757194 CTGTCCCCACTTATAAACTGGGG - Intronic
1146591101 17:34128558-34128580 CCTTCTCCACTGAAAGGATGAGG - Intronic
1150036360 17:61803383-61803405 TTATTTCCAGTGATAGAATGGGG - Intronic
1150154091 17:62836009-62836031 TGGTCTCCACTGATACCATGGGG - Intergenic
1153896077 18:9561674-9561696 CTGTCTTCAATGATAAAAAGAGG + Intronic
1155149410 18:23111154-23111176 CTGCCTCAACCAATAGAATGTGG + Intergenic
1155487125 18:26357171-26357193 CTGTCTCCATTAATAAAAAGAGG + Intronic
1157560939 18:48645609-48645631 CTGTCTCCAGTGACACCATGGGG - Intronic
1158745279 18:60192746-60192768 CTTTCCCAACTGATTGAATGAGG + Intergenic
1159447904 18:68562835-68562857 CAGTCTCTACAGAAAGAATGAGG + Intergenic
1159504279 18:69314796-69314818 CTGTCATCACTCAAAGAATGAGG + Intergenic
1164131845 19:22370468-22370490 CTGTTTCCACTGATATAAAGTGG - Intergenic
1164167775 19:22697854-22697876 CTGTTTCCACTGATATAAAGTGG + Intergenic
1164881846 19:31739381-31739403 TTGTTTCCATTGAAAGAATGCGG - Intergenic
1202672423 1_KI270710v1_random:2632-2654 CTGTTTCTAGTGATAGAATTTGG + Intergenic
925505699 2:4560996-4561018 TTGTTTCCGCTGGTAGAATGTGG + Intergenic
927089167 2:19697517-19697539 CTGTTTCAACTCATAGAATGTGG - Intergenic
928353999 2:30591711-30591733 CTGTCTCCCTTAATAGACTGTGG - Intronic
929937402 2:46303548-46303570 CTGTCTCCACTGATATTCTCAGG - Intronic
930858667 2:56045919-56045941 CTGGTTCCCCTGATAGAATGAGG - Intergenic
930886680 2:56334199-56334221 CTGTCTTCACCGCTGGAATGTGG + Intronic
931197770 2:60069104-60069126 GTGTCTCCACAGATAGACTTGGG + Intergenic
931427490 2:62184378-62184400 GTGTATCTACTGCTAGAATGAGG + Intergenic
931514176 2:63032797-63032819 CTGTCTGCTAAGATAGAATGTGG - Intronic
933260264 2:80124393-80124415 ATGTCTTCACTGGTAAAATGGGG - Intronic
935467935 2:103421396-103421418 TTGTCTCCACTGAGAGGGTGTGG - Intergenic
935614690 2:105065043-105065065 CTGTCTCCACTGATAGAATGAGG + Intronic
935715160 2:105932958-105932980 CTGTCTCCAAAGAGAGAATAGGG - Intergenic
937445143 2:121951033-121951055 CTGTTTCCACTGACTGAAAGGGG + Intergenic
939089803 2:137766452-137766474 CTATTTGCTCTGATAGAATGTGG - Intergenic
942059720 2:172216981-172217003 CTGTTTCAAGTGATAGGATGAGG + Intergenic
942424774 2:175847971-175847993 GTGTCTCCACTTCTAAAATGGGG + Intergenic
942743415 2:179205112-179205134 CTTTCTCCACTGATTAAAAGAGG - Intronic
945385239 2:209190516-209190538 CTGTCTCTTCTGATAGATTGTGG + Intergenic
945511906 2:210713467-210713489 AAGTCTCCACCGATTGAATGAGG + Intergenic
946126996 2:217571579-217571601 CTCTCTCCACTTAGAGAATTGGG - Intronic
946761741 2:223001036-223001058 CTTTCTCCTTTGATAGAAAGGGG + Intergenic
946946690 2:224829192-224829214 ATGTCTGCCCTGATAGAGTGGGG + Intronic
948336380 2:237210695-237210717 CTGTCTCAACCCCTAGAATGGGG - Intergenic
948672912 2:239579918-239579940 CTTTCTCCACTGATAGGGTTTGG - Intronic
1169217781 20:3803388-3803410 CTGGCTCCTCTGACAGACTGCGG + Exonic
1170438642 20:16355377-16355399 GTTTCCCCACTGATACAATGAGG - Intronic
1173809358 20:45946899-45946921 CCGTCTCCACTGAATGAATGAGG - Intronic
1174548978 20:51347781-51347803 CTGCCTCTGCTAATAGAATGTGG - Intergenic
1175102275 20:56587915-56587937 CTGTTTCCATTTATAGAATCAGG - Intergenic
1175312096 20:58019199-58019221 CTTTTTCCACTGCTAGACTGAGG - Intergenic
1175393856 20:58645114-58645136 CTGTCTCCCAAGCTAGAATGTGG - Intergenic
1178221343 21:30663666-30663688 CAGCCTCAACTAATAGAATGAGG + Intergenic
1180819433 22:18815653-18815675 TTGTCTGCACTGAAAGAAGGTGG - Intergenic
1181205658 22:21250098-21250120 TTGTCTGCACTGAAAGAAGGTGG - Intergenic
1203221265 22_KI270731v1_random:45315-45337 TTGTCTGCACTGAAAGAAGGTGG + Intergenic
1203269561 22_KI270734v1_random:41506-41528 TTGTCTGCACTGAAAGAAGGTGG - Intergenic
949385411 3:3496860-3496882 CCGTCACCACTAAAAGAATGGGG - Intergenic
950067297 3:10123259-10123281 CTGTTTTCACAGATGGAATGTGG + Intronic
950481769 3:13248465-13248487 CAGTCTCCCCTGAGAGAACGTGG + Intergenic
951487491 3:23230386-23230408 CTTATTTCACTGATAGAATGTGG + Intronic
953097108 3:39788933-39788955 CTGTTTCAACTAACAGAATGTGG + Intergenic
953805524 3:46064525-46064547 CTTGCTTGACTGATAGAATGTGG + Intergenic
956145677 3:66188576-66188598 CTGCCTCCACTCATAGAAGAAGG - Intronic
956582557 3:70830685-70830707 CTGTGGCCACTGATTTAATGTGG - Intergenic
959655432 3:108799165-108799187 GTGTCTTCACTGATAGAAGAGGG + Intergenic
959711186 3:109387454-109387476 CTGTCTCAACACATAAAATGAGG + Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
961792163 3:129384119-129384141 CAGCCTCCCCTGTTAGAATGTGG + Intergenic
963351811 3:144160844-144160866 CTGTATCCACAGTTAGAATGTGG + Intergenic
963611660 3:147476296-147476318 TTGCTTCCACTGATAGAAAGTGG - Intronic
967511022 3:190312531-190312553 GTGTCTCCACAGATACTATGTGG - Intronic
967932896 3:194703197-194703219 CTGTCTGCACTGAGAGGCTGAGG - Intergenic
968569267 4:1331100-1331122 TTGTCTCCAGAGATGGAATGAGG + Intronic
971197783 4:24485990-24486012 CTGTTTACTCTGATAGACTGAGG + Intergenic
972093041 4:35312592-35312614 CTGTCTCTACCAATAGAGTGTGG + Intergenic
972759274 4:42086607-42086629 CTGTCTTTCCTTATAGAATGTGG + Exonic
973314572 4:48746659-48746681 CTGCCTCCACAAACAGAATGTGG + Intronic
979289281 4:118961933-118961955 TTGTCTCTACTGACAGAATGAGG + Intronic
980141060 4:128917830-128917852 CTGTTACCACTGAGAGAAAGGGG + Intronic
981110938 4:140932642-140932664 GTTTCTTCACTGATAAAATGAGG + Intronic
981258531 4:142691897-142691919 CTGTCTCCTCTGAAAGGAGGAGG + Intronic
981305376 4:143241524-143241546 CTGTATCCAGGGATAGAATGGGG + Intergenic
984286273 4:177732934-177732956 TTGTGTCCACTGCTAGTATGTGG + Intronic
985841729 5:2310991-2311013 CTCTCTCCCGTGACAGAATGAGG - Intergenic
988218734 5:28314079-28314101 CGCTCTCCATTCATAGAATGTGG - Intergenic
989960603 5:50410055-50410077 CTGTCTGCTGTGACAGAATGTGG - Intronic
991023660 5:62007390-62007412 CTGTCTCCTCTTCTAGAACGTGG - Intergenic
992925186 5:81576452-81576474 GTTTCTCCACTGATAAAATAAGG - Intronic
993474295 5:88345509-88345531 TTGTCTCTACTGACAGGATGGGG + Intergenic
993729227 5:91402857-91402879 ATTTCTTGACTGATAGAATGGGG + Intergenic
993866898 5:93206413-93206435 GTGTCTTCACCTATAGAATGAGG - Intergenic
995978740 5:118075556-118075578 GTATCTTCACTGATAAAATGAGG - Intergenic
998224689 5:140317686-140317708 CTGTCTCCTCTATTAGACTGAGG + Intergenic
998480225 5:142457029-142457051 GTGTCTCCACTTGTAAAATGAGG - Intergenic
1001443878 5:171768052-171768074 CTGTTTCTACTGATAGGATGTGG - Intergenic
1003494383 6:6651510-6651532 CTGTCTTCACTTCTAGTATGAGG + Intronic
1004161289 6:13215472-13215494 CTGTCTCCAGATAGAGAATGAGG + Intronic
1006259705 6:32857598-32857620 CTGTGTTCACATATAGAATGTGG - Intronic
1006656899 6:35603048-35603070 GTTTCTTCACTGATAGAATGTGG + Intronic
1007629076 6:43262846-43262868 CTGTGTCCACTGACAGCATCTGG - Exonic
1008181943 6:48342205-48342227 CAGTCTCTACTGAGAGAATATGG + Intergenic
1009613707 6:65978595-65978617 CAGTTTCCACTCATAGAAGGAGG - Intergenic
1010392040 6:75349087-75349109 ATGTCTCCACCTGTAGAATGAGG + Intronic
1012960482 6:105616661-105616683 CTGTCCCCACAGATGGAATGAGG - Intergenic
1014500754 6:122186000-122186022 CTGTCTTGACCAATAGAATGTGG + Intergenic
1015772723 6:136785524-136785546 CTGTGTCCACTGAAGGAGTGAGG + Intronic
1016821516 6:148350357-148350379 CTCTCTATACTGATAGAATGTGG + Intronic
1017786547 6:157761694-157761716 GTTTCTCCATTGGTAGAATGGGG + Intronic
1018961059 6:168448664-168448686 CTGTCTCCACTGAGGCAATGAGG + Intronic
1019769046 7:2871796-2871818 CTGTCTCCACAGTTAGGCTGGGG + Intergenic
1022171500 7:27836341-27836363 CTGTCCCCTCTGATGGAATTAGG + Intronic
1022262438 7:28719432-28719454 CTGTCCCCACTTTTTGAATGAGG + Intronic
1024758784 7:52568706-52568728 CAGTCTCAAATGACAGAATGAGG - Intergenic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1026144576 7:67735474-67735496 CTGTCTCTACTAAAAAAATGTGG + Intergenic
1026427801 7:70313937-70313959 CAGTCTCCAGTGCTAAAATGCGG - Intronic
1027970012 7:85067720-85067742 ATGTTTCCACTGATATAATCAGG + Intronic
1029819573 7:103132932-103132954 CTGTTTCCACAGATTGATTGGGG - Intronic
1031762778 7:125735268-125735290 CTGTCTCCTCTTATGGAAAGTGG - Intergenic
1032506399 7:132437880-132437902 CTGTCTCCACTGAGAAAGAGAGG + Intronic
1033276405 7:139974888-139974910 CTTTCCCCACTGATGAAATGGGG - Intronic
1034188941 7:149198888-149198910 CTGTCTCCACTGAAACAACCTGG + Intronic
1038320262 8:26519319-26519341 CTTTCTTCACTTCTAGAATGAGG - Intronic
1043291795 8:78611201-78611223 CTGTCTCCACTCATAACATGTGG + Intergenic
1043482541 8:80667847-80667869 GTTTCTCCACTTATAAAATGGGG + Intronic
1044091340 8:88006175-88006197 TAGTCTGCACTGATAGAATATGG + Intergenic
1046564947 8:115886930-115886952 CTGTCTCCCCTACTAGACTGCGG + Intergenic
1047859189 8:128946024-128946046 CTTTCTTCACTTTTAGAATGAGG - Intergenic
1048190110 8:132280622-132280644 CTGTGACCACTGATAGAGTTTGG - Intronic
1049945881 9:595241-595263 CTGTCTCTACTTTTAAAATGTGG + Intronic
1051214731 9:14784369-14784391 CTGTCTCCAGTGACAGATTCAGG - Exonic
1051726733 9:20095469-20095491 CAGGCTCAACTGATAGGATGAGG - Intergenic
1052730035 9:32274714-32274736 CTCTCTCCCTTGATTGAATGTGG - Intergenic
1053327546 9:37168865-37168887 CTGTCTCCCCTACTAGAATGTGG - Intronic
1056111130 9:83396175-83396197 CTCTCTCCACATAGAGAATGGGG - Intronic
1058372013 9:104280283-104280305 CTTTCCTCACTGATAAAATGTGG - Intergenic
1060671387 9:125472970-125472992 CTTTCTCGACTGTTAAAATGTGG + Intronic
1061579141 9:131526215-131526237 CTGTCTTCTGTGATGGAATGGGG - Intronic
1062109728 9:134775370-134775392 CTGTCTCCACCGATAGCATCTGG + Intronic
1185523244 X:757467-757489 CTGTCTGCACTGATAAAATATGG - Intergenic
1186501889 X:10057926-10057948 CAGTCTCCACAGACAGACTGGGG - Intronic
1187205733 X:17179257-17179279 CTATTTCCACAAATAGAATGTGG + Intergenic
1187958650 X:24545839-24545861 CTGTCTCCCCTAATAGAAAGTGG - Intergenic
1189820825 X:44868769-44868791 CCCCCTCCACTGATACAATGGGG + Intergenic
1189905371 X:45753869-45753891 CTTTCTTCACTCATAGAAAGAGG - Intergenic
1193028064 X:76866845-76866867 ATCTCTCCACTGATAGCAAGTGG + Intergenic
1197870136 X:131057018-131057040 TTTTCTCCACTGGGAGAATGGGG - Intergenic
1198105938 X:133461385-133461407 CTGTCTTCACTGTTAATATGTGG - Intergenic
1199297621 X:146176934-146176956 AAGTCCCCACTGAAAGAATGTGG + Intergenic
1201170192 Y:11252320-11252342 CTGTTTCTAGTGATAGAATTTGG + Intergenic