ID: 935615362

View in Genome Browser
Species Human (GRCh38)
Location 2:105074522-105074544
Sequence GAAGCACTTAGAACTATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1781
Summary {0: 1, 1: 5, 2: 64, 3: 327, 4: 1384}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935615362_935615364 8 Left 935615362 2:105074522-105074544 CCAGGCATAGTTCTAAGTGCTTC 0: 1
1: 5
2: 64
3: 327
4: 1384
Right 935615364 2:105074553-105074575 TAACTTACACTCTTCACAACAGG 0: 1
1: 0
2: 0
3: 11
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935615362 Original CRISPR GAAGCACTTAGAACTATGCC TGG (reversed) Intronic
900905127 1:5551728-5551750 GTAGCACTTGGAACAATTCCAGG - Intergenic
901329151 1:8391320-8391342 AAAGCACTGAGAACAGTGCCTGG + Intronic
901763225 1:11484143-11484165 GAAGCATTTAGCACACTGCCTGG - Intronic
901792698 1:11662648-11662670 GAAGCATTTAGAATGGTGCCTGG + Exonic
901879963 1:12188015-12188037 GAAACGCTTAGAACAGTGCCTGG + Intronic
901885160 1:12217619-12217641 GAAATGCTTAGAACTGTGCCTGG + Intergenic
902096683 1:13951384-13951406 AAAGCACTTAGACCCATGCCTGG + Intergenic
902115776 1:14119890-14119912 AAAGCCCTTAGAACAGTGCCTGG - Intergenic
902134645 1:14294429-14294451 GCAGAGCTTAGCACTATGCCTGG - Intergenic
902556459 1:17249678-17249700 GAAGCTCTTAGAATAGTGCCTGG - Intronic
902807270 1:18868958-18868980 GAAGCATTTAGCCCAATGCCTGG + Intronic
902842240 1:19082241-19082263 AAAGCACTTAGAGCAGTGCCTGG - Intronic
902954611 1:19916825-19916847 AAAGCACTTACAACAGTGCCTGG + Intergenic
903240265 1:21978098-21978120 GATACACTTAGAACAATGCCTGG - Intronic
903244013 1:22002732-22002754 GATACACTTAGAACAATGCCTGG - Intronic
903313371 1:22478635-22478657 AAAGCATTTAGAACAGTGCCTGG + Intronic
903344317 1:22674699-22674721 GAAGCATTTAGAACAGTGCCTGG + Intergenic
903366517 1:22808671-22808693 TAAGAGCTTAGAACTGTGCCTGG - Intronic
903380668 1:22894947-22894969 AAAGCACTTAGAACAACACCTGG - Intronic
903434564 1:23336951-23336973 AAAGCACTTAGAATAATGCCTGG - Intronic
903469559 1:23576426-23576448 AAAGCACTTAGAATGGTGCCTGG - Intergenic
903567219 1:24277152-24277174 AAAGCACTTAGAACACAGCCTGG - Intergenic
903617124 1:24668298-24668320 AAAGCACCTAGCACTTTGCCTGG - Intronic
903640759 1:24858441-24858463 GAAGCCCTTAGAACAGTGCTTGG + Intergenic
903683892 1:25116940-25116962 TAAGCACTTAGAAGAATGTCAGG + Intergenic
903809493 1:26027398-26027420 AAAGCACTTAGAACAGTACCTGG + Intronic
903895367 1:26599765-26599787 TCAGCACCTAGAACTGTGCCTGG - Intergenic
904201997 1:28825943-28825965 CAAGTACCTAGAACTGTGCCTGG - Intronic
904252092 1:29232306-29232328 GAAGCATTTAGTACAATGCTTGG + Intergenic
904270339 1:29345656-29345678 AAAGCATTCAGTACTATGCCTGG + Intergenic
904490607 1:30856715-30856737 CGAGCACTTAGAACTGTTCCTGG - Intergenic
904853816 1:33479844-33479866 AAAGCACTTAGAACACTTCCTGG - Intronic
904854387 1:33486127-33486149 GAACCATTTTGAAATATGCCAGG - Intronic
904860213 1:33532311-33532333 AAAGCATTTAGCACAATGCCTGG + Intronic
904865833 1:33578246-33578268 CAAGCACTTAGAACAATATCTGG - Intronic
904876059 1:33655377-33655399 AAAGCAATAAGAACTGTGCCTGG - Intronic
904903515 1:33876525-33876547 GAGGGACTTAGAACAGTGCCTGG - Intronic
904909971 1:33927440-33927462 GAAGCATTTTGCACAATGCCTGG - Intronic
904954835 1:34274272-34274294 AAAGCACTTGAAACTGTGCCTGG - Intergenic
904960122 1:34326032-34326054 AAAGCACTTAGAACTATCCCTGG - Intergenic
904973049 1:34434158-34434180 GAAGCACTTAGAACAGTGTCTGG + Intergenic
905237412 1:36559692-36559714 AAAGCACTTAGAATCAAGCCTGG - Intergenic
905348492 1:37328057-37328079 AAGGCAATTAGAACTGTGCCTGG + Intergenic
905356637 1:37389424-37389446 AAAGCACTTAGAACAGTGCCCGG - Intergenic
905483292 1:38276295-38276317 GAAGCACTTAGAAGGATACCTGG + Intergenic
905844650 1:41218702-41218724 AAAGCACTTAATACCATGCCTGG - Intronic
905853613 1:41292495-41292517 AAAGCACTTAGAACAATGCCTGG + Intergenic
905925768 1:41748591-41748613 TAAGCACTTAGAACAGTACCTGG - Intronic
906008212 1:42497698-42497720 AAAGCACCTAGTATTATGCCAGG - Intronic
906014113 1:42558463-42558485 CAAGCACTTAGCACAATGTCTGG - Intronic
906161286 1:43650682-43650704 GAAGCACTAAGCACTAGGCCCGG - Intronic
906188590 1:43880857-43880879 AGAGCACTTAGAACAGTGCCAGG + Intronic
906275417 1:44511706-44511728 GAACCACTTATAATTATGTCTGG + Intronic
906636000 1:47411075-47411097 GAAGTTCTTAGAACACTGCCTGG - Intergenic
906651290 1:47514802-47514824 AAAGCACTTACAACACTGCCTGG - Intergenic
906692793 1:47803756-47803778 GCAGCACTCAGCACTGTGCCTGG + Intronic
906693278 1:47806996-47807018 CCAGCACCTAGAACAATGCCTGG - Intronic
906712562 1:47941913-47941935 GAAGTTCTTGGAACAATGCCTGG + Intronic
906812750 1:48845902-48845924 AAAGTACTTAGAACAGTGCCTGG + Intronic
906865167 1:49410373-49410395 CCAGAACTTAAAACTATGCCGGG - Intronic
906883961 1:49624266-49624288 AAAGCATTTAGCACCATGCCTGG + Intronic
906916766 1:50020795-50020817 AAAGCACTTAGTACAATGCGTGG + Intronic
906927806 1:50137926-50137948 GGAGCACTCAGCACTATTCCTGG - Intronic
906938639 1:50236399-50236421 CAAGCACTTAGAACAATGCTTGG + Intergenic
907036016 1:51216947-51216969 AAAACATTTAGAACAATGCCGGG + Intergenic
907427523 1:54390040-54390062 AAAGCACTTACAACAGTGCCTGG + Intronic
907474750 1:54698289-54698311 AAAGCACTTAGAACAGTGCCTGG + Intronic
907550605 1:55301593-55301615 GAATCATTTACAACAATGCCTGG - Intergenic
907660375 1:56386914-56386936 AAAGCATTTAGAACAATGCCTGG + Intergenic
907668263 1:56451902-56451924 AAAGCACTTAAAATAATGCCTGG - Intergenic
907702091 1:56798699-56798721 GAAGTGCTTAGAACAGTGCCTGG - Intronic
907737374 1:57127799-57127821 GACGTACTTAGCACCATGCCTGG + Intronic
907812607 1:57886521-57886543 GAAGGGCTTAGAACAGTGCCTGG - Intronic
907813159 1:57892411-57892433 AAAGCACTTAGAACAGTGCCTGG - Intronic
907831284 1:58066500-58066522 AAAGCACTTAGAACAGGGCCTGG - Intronic
907853808 1:58281843-58281865 AAAGCACTTAGAACAATGACTGG + Intronic
907985512 1:59525524-59525546 AAAGCACTTAGAATAATGTCTGG + Intronic
908072473 1:60477385-60477407 AAGGCACTTAGAACAGTGCCTGG + Intergenic
908198764 1:61772877-61772899 GAAGAACTAAGCACTGTGCCTGG + Intronic
908417617 1:63928789-63928811 AAAGCTCTTAGAACAGTGCCTGG + Intronic
908443213 1:64176360-64176382 AAAGCACTCAGACCTATGTCTGG - Intronic
908623002 1:66006988-66007010 CAAGCACTTGCCACTATGCCTGG - Intronic
908757276 1:67480445-67480467 AAAGTACTTAGAACAATGCCTGG - Intergenic
908784719 1:67723590-67723612 AAAGCCCTTAGAACAATGCTTGG - Intronic
908797256 1:67843249-67843271 CAAGCACCTAGAACTGTTCCTGG - Intergenic
908822316 1:68101250-68101272 AAAGCACCTAGCACCATGCCTGG + Intronic
908838005 1:68248016-68248038 GAAGAACTTAGATCAGTGCCTGG + Intergenic
908961371 1:69700326-69700348 AAAGCATTTAGAACAATTCCTGG + Intronic
909272672 1:73643969-73643991 AAAGCAGTTAGAACTGGGCCTGG + Intergenic
909567411 1:77068819-77068841 GAAGCACATAGAAGAATGCTCGG - Intergenic
909877060 1:80819965-80819987 CCAGCACCTAGAACAATGCCTGG + Intergenic
909897944 1:81097272-81097294 GAAGCACTTAGAAGAGTGCTAGG - Intergenic
909905874 1:81193907-81193929 AAAGCATTTAGAACTATGCCAGG + Intergenic
910038001 1:82812039-82812061 GAAGTACCTAGAATAATGCCTGG - Intergenic
910114401 1:83716377-83716399 GAAGTTCTTAGAACTGTGCCTGG - Intergenic
910131146 1:83907987-83908009 GTAGCACTTAGCACAATGCCTGG - Intronic
910178171 1:84453496-84453518 CTAGCACTTAGAACAGTGCCTGG - Intergenic
910241265 1:85088571-85088593 AAAGCACTTAGAAGAATGCCTGG - Intronic
910437923 1:87224593-87224615 AAAGCACTTAGAACAGTTCCTGG + Intergenic
910486302 1:87718265-87718287 TAAGCACTTAGAACAGTGCAAGG - Intergenic
910552321 1:88489600-88489622 AAAATCCTTAGAACTATGCCTGG - Intergenic
910680885 1:89863231-89863253 GAAGCATTTAGAACAGTGACTGG + Intronic
910863821 1:91769178-91769200 AAAGCACTTAGAACAGTGACTGG + Intronic
910893148 1:92039032-92039054 GAAGCACTTAGAATTGGGCCTGG + Intronic
911442930 1:97951668-97951690 GAAACACTTAGAACAATGCCTGG - Intergenic
911648317 1:100359195-100359217 AAACCACTTAGAACACTGCCTGG - Intronic
911654262 1:100425023-100425045 CAAGCACATACCACTATGCCTGG - Intronic
911721168 1:101192711-101192733 AAAGTACTTAGAATTAAGCCTGG - Intergenic
911721660 1:101197893-101197915 GAAGCACTTAGAAGAGTGCCTGG - Intergenic
911754911 1:101542745-101542767 TAGGCATTTAGAACAATGCCTGG - Intergenic
911874817 1:103147168-103147190 TAAGGACTTAGAAAAATGCCCGG + Intergenic
912111922 1:106353786-106353808 TAAGCACCTAGAATGATGCCTGG - Intergenic
912267321 1:108171753-108171775 GAAATACTTAGAACAATGCCTGG - Intronic
912273898 1:108236765-108236787 GCAGCACTGAGAACTAAGCTGGG + Intronic
912287369 1:108383097-108383119 GCAGCACTGAGAACTAAGCTGGG - Intronic
912294321 1:108457558-108457580 GCAGCACTGAGAACTAAGCTGGG - Intronic
912502645 1:110132303-110132325 AAAGCAGTTAGAACAGTGCCTGG + Intergenic
912558144 1:110530966-110530988 AAAACACTTAGAACAATGCCTGG + Intergenic
912711885 1:111955959-111955981 TAACCACTTGGAACTGTGCCTGG - Intronic
912906390 1:113712513-113712535 AAAGTACTCAGAACAATGCCTGG + Intronic
912945950 1:114084307-114084329 AAAGCACTTAGAACAATGCCTGG + Intergenic
913141701 1:115947642-115947664 GAGGCACTTAGAAGACTGCCTGG + Intergenic
913255412 1:116948929-116948951 AAAGCACTCAGAACACTGCCTGG + Intronic
913261361 1:117000828-117000850 AAAGCACTTAGAACAATATCTGG - Intergenic
913277042 1:117148429-117148451 AAAGCACTTAGAACAGTGTCTGG + Intronic
913320283 1:117583107-117583129 AAAGAGCTTAGAACTCTGCCTGG + Intergenic
913370191 1:118090176-118090198 AAAGCATTTAGAACAGTGCCTGG + Intronic
913678240 1:121163074-121163096 GAAGCACTTGGAACAATGCCTGG + Intergenic
913678723 1:121167585-121167607 AAAGCACTTAGAACAGTGTCTGG + Intergenic
913973584 1:143435911-143435933 AAAGGACTTAGAACAATACCTGG - Intergenic
914030080 1:143950714-143950736 GAAGCACTTGGAACAATGCCTGG + Intronic
914030554 1:143955229-143955251 AAAGCACTTAGAACAGTGTCTGG + Intronic
914067972 1:144261518-144261540 AAAGGACTTAGAACAATACCTGG - Intergenic
914111183 1:144704836-144704858 AAAGGACTTAGAACAATACCTGG + Intergenic
914158893 1:145112732-145112754 AAAGCACTTAGAACAGTGTCTGG - Intergenic
914159369 1:145117237-145117259 GAAGCACTTGGAACAATGCCTGG - Intergenic
914433172 1:147638241-147638263 AAAGCATTTAGAACAATGGCTGG - Intronic
914450309 1:147785744-147785766 TAAGCACTTAGACCACTGCCTGG - Intergenic
915576553 1:156782733-156782755 AAAGCACTTAGAACAGTGCCTGG - Intronic
915587286 1:156851038-156851060 AAAGCACATAAAACAATGCCTGG - Intronic
915680076 1:157572863-157572885 CAAGTACCTAGAACTCTGCCTGG - Intergenic
915957980 1:160239249-160239271 TAAGCAGTTAGAACTGTGACTGG - Intronic
915996859 1:160572509-160572531 AAAGCACTTAGCACAATGCCTGG + Intronic
916004144 1:160644445-160644467 AAAGCATTTAGAACAGTGCCTGG + Intronic
916098234 1:161370650-161370672 AAAGCAATTAGAACTGTGCCTGG - Exonic
916125163 1:161563748-161563770 AAAGCACTTAGCACCATGTCTGG + Intergenic
916135053 1:161645094-161645116 AAAGCACTTAGCACCATGTCTGG + Intronic
916170842 1:162000454-162000476 AAAGCACTTAGAACAGTGCCTGG - Intronic
916259203 1:162823589-162823611 AATGCACTTAGAACGGTGCCTGG - Intergenic
916294466 1:163202280-163202302 GAAGCACTCAGAACCATGTCTGG - Intronic
916349081 1:163828418-163828440 AAAGCACTTAGCACAGTGCCTGG - Intergenic
916513440 1:165493919-165493941 AAAGCACTTAGAACAGTGCCTGG - Intergenic
916602018 1:166302481-166302503 GAAGGTCTTAGAAGAATGCCAGG - Intergenic
916828827 1:168470086-168470108 GAAGTACTTAGAACATTGCCTGG + Intergenic
917137001 1:171797563-171797585 AAACCACTTAGAAGAATGCCTGG - Exonic
917332270 1:173893699-173893721 GAAGCACATAGAACTGTGCCTGG - Exonic
917719306 1:177771048-177771070 AAAGCACTTAGAACACTGTCTGG - Intergenic
917756726 1:178108435-178108457 AAAGCACTTAGAACTGTGCCAGG - Intronic
917909055 1:179622118-179622140 AAGGCACTTAGAACAGTGCCTGG + Intronic
918005825 1:180541317-180541339 GAAGCACTTAGAACAATGCCTGG + Intergenic
918049003 1:180958223-180958245 AAAGTACTTAGAACAGTGCCTGG + Intergenic
918438537 1:184542263-184542285 AAAGTGCTTAGAACTGTGCCTGG - Intronic
918568484 1:185958619-185958641 AAAACACTTAGAACAATGCCTGG - Intronic
918599800 1:186342986-186343008 GAAGCATTTAGAAGCATGTCTGG - Intronic
918666844 1:187161989-187162011 AAAGCACTTAAAACCATGCCTGG - Intergenic
919175031 1:194009500-194009522 GAAGGACTCAGAATTATGCTGGG - Intergenic
919592656 1:199523767-199523789 AAAGCACTTAGAACAGCGCCAGG + Intergenic
919769818 1:201150408-201150430 ATAGCACTTAGAACAATACCTGG - Intronic
920033845 1:203052991-203053013 AAAGCCCTTAGCACTGTGCCTGG - Intronic
920465547 1:206181598-206181620 GAAGCACTTGGAACAATGCCTGG + Intergenic
920466021 1:206186121-206186143 AAAGCACTTAGAACAGTGTCTGG + Intergenic
920642604 1:207768142-207768164 AAAGCACTTAGCACAGTGCCTGG + Intronic
920658158 1:207891702-207891724 AAAGCACTCAGAACTGTGCCTGG - Intronic
920712309 1:208306945-208306967 GAAGCAATTATTACCATGCCTGG - Intergenic
920849749 1:209620748-209620770 AAAGCACTTGGAACAGTGCCTGG + Intronic
920868862 1:209776317-209776339 AAAGCACTTAGCACAATGCCTGG + Intronic
920938744 1:210460420-210460442 CAAGCACCTAGAACCATGCTTGG + Intronic
921064140 1:211610839-211610861 AAAGCAGTTAGAACTGTACCTGG - Intergenic
921170418 1:212542640-212542662 AAAGCACTTAGCGCGATGCCTGG - Intergenic
921253780 1:213321403-213321425 AAAGCACTTACCACAATGCCTGG + Intergenic
921358756 1:214311264-214311286 GAAGCACTCAGAACGGTGCCCGG - Intronic
921464799 1:215474776-215474798 CTAACCCTTAGAACTATGCCTGG - Intergenic
921620785 1:217324114-217324136 GATGCACTCAGAACTCTGCTGGG - Intergenic
921746344 1:218744108-218744130 CAAGCATATGGAACTATGCCAGG - Intergenic
921863478 1:220064036-220064058 AAAGCACTTAGAATGGTGCCTGG - Intronic
922276582 1:224084582-224084604 AAAGTACTTAGAACCATGCCTGG - Intergenic
922454837 1:225766305-225766327 CAATTACTTAGAACTGTGCCTGG - Intergenic
922581228 1:226699587-226699609 AAACCACTTAGAACAATGCCTGG + Intronic
922604417 1:226880671-226880693 GAAGAACTTCAAACAATGCCTGG - Intronic
923156066 1:231280461-231280483 CAAGCACCTACCACTATGCCAGG - Intergenic
923224921 1:231930379-231930401 AAAGCACTTAGAGCGATCCCTGG - Intronic
923758566 1:236817496-236817518 AAAGCACTTAGAACAGAGCCTGG - Intronic
923889548 1:238197435-238197457 TTAGCACTTAGCACTGTGCCTGG - Intergenic
924414641 1:243846925-243846947 AAAGCACATAGAACAGTGCCTGG + Intronic
924574041 1:245262958-245262980 AAAGCACTTAGAACCATACCTGG + Intronic
924591145 1:245405755-245405777 AAAGCCCTTAGATCTATTCCAGG - Intronic
1063855782 10:10252166-10252188 GAATCATTTAGTACTCTGCCTGG - Intergenic
1064226336 10:13489074-13489096 GGAGCACTTAGAACAAGGCCTGG - Intronic
1064371922 10:14759594-14759616 TTAGCACCTAGAACAATGCCTGG + Intronic
1064703465 10:18046252-18046274 GAAGCACTTAGCACTGTGCCTGG + Intergenic
1064742143 10:18444451-18444473 GAAGGACTTAGAATAATGCTTGG - Intronic
1065137833 10:22690125-22690147 TAAACCCTTAGAACCATGCCTGG - Intronic
1065305822 10:24367750-24367772 AAGGCACTTAGAACAGTGCCTGG - Intronic
1065359955 10:24880156-24880178 TAAGCACTTAGAAAAGTGCCTGG + Intronic
1065508140 10:26450234-26450256 AAAGCACTTAGAATAATGCCTGG + Intronic
1065617895 10:27547393-27547415 CTAGGACTTAGAACCATGCCTGG - Intergenic
1065634435 10:27716182-27716204 GTAGCACATAGCACAATGCCAGG + Intronic
1065765726 10:29027804-29027826 AAAGCACTTAGACCAGTGCCTGG - Intergenic
1065820212 10:29518243-29518265 CAAGCACTTACTACCATGCCTGG - Intronic
1065984104 10:30932429-30932451 AAAGCACTTAGTACATTGCCTGG - Intronic
1066127143 10:32352454-32352476 AAAGCACTTAGAATCATCCCTGG + Intronic
1067075100 10:43174097-43174119 CTAGCACCTAGAACAATGCCAGG - Intronic
1067151938 10:43743051-43743073 TAAGCACCTAGAACAGTGCCTGG + Intergenic
1067289466 10:44930756-44930778 AAAGCACTTAGGACCATGCTTGG - Intronic
1067537229 10:47122117-47122139 AAAGCACTTAGAAAAATTCCTGG - Intergenic
1067743566 10:48915178-48915200 AAAGCACTTATAACAGTGCCTGG + Intronic
1068049058 10:51925968-51925990 AAAGCACTTAGCACAATGCATGG + Intronic
1068068233 10:52160937-52160959 AAAGCACTTATAGCAATGCCTGG + Intronic
1068447888 10:57146658-57146680 GAAGGCCTTAGGACTCTGCCTGG - Intergenic
1068515961 10:58025852-58025874 AAAGCACTTAGAATGATGCCTGG + Intergenic
1068606539 10:59011379-59011401 GAAGCACTTAGCACAATGCCTGG + Intergenic
1068758413 10:60680937-60680959 AAATCACTTAGAACAGTGCCTGG + Intronic
1068771570 10:60827106-60827128 GAAGCACTTAGAACTAGGTGTGG - Intergenic
1068920017 10:62473651-62473673 AAAGCTCTTAGAACCATGCCTGG + Intronic
1068949029 10:62759035-62759057 AAAGCACTTAGTATAATGCCTGG - Intergenic
1069419847 10:68237479-68237501 AAAGCACTTAGATCTATGCCTGG + Intergenic
1069558585 10:69413871-69413893 GAAGCCCTTAGCACCATGCCTGG - Intronic
1069627849 10:69879318-69879340 AAAGTACTTAAAACAATGCCTGG - Intronic
1069676017 10:70248443-70248465 AAAGTACGTAGTACTATGCCTGG + Exonic
1069703560 10:70442724-70442746 AGAGCACTTAGCACTATGCCTGG - Intronic
1069705305 10:70455777-70455799 GAAGCACTCAGCACCATGCCTGG - Intergenic
1069729809 10:70603247-70603269 GAAGTGCTTGGAACTGTGCCTGG + Intergenic
1069843386 10:71354178-71354200 GAAGCACTCAGAAGCCTGCCTGG - Intronic
1069856103 10:71442044-71442066 CAAGCACTTAGAATAGTGCCTGG + Intronic
1069912529 10:71768121-71768143 CAAGCACTTAGAATGATGCCTGG - Intronic
1069993759 10:72330203-72330225 AAAGCACTTAGAACAGTGCCTGG - Intergenic
1070151895 10:73810677-73810699 GAAGCTCTTAGAAGAATGGCTGG - Intronic
1070350937 10:75591785-75591807 CCAGCACCTAGAACTGTGCCTGG - Intronic
1070360702 10:75685902-75685924 AAAGCACTTAGAACTGTAGCTGG - Intronic
1070414314 10:76175411-76175433 GTAGCTCTTAGAATGATGCCTGG + Intronic
1070482159 10:76893229-76893251 GAAGCACTTAGAAACATGCTTGG + Intronic
1071328219 10:84537200-84537222 AAAGCGCTTAGAACAATGCCTGG - Intergenic
1071718724 10:88121916-88121938 AAAGCACTTAGCATGATGCCTGG - Intergenic
1071791184 10:88955985-88956007 GAAGCACCTAGAACACTGCCTGG + Intronic
1071821187 10:89282700-89282722 GAAGCTCTTAGAATAGTGCCTGG - Intronic
1072673448 10:97448347-97448369 AAAGCACTTAGCACAATACCCGG - Intronic
1072734369 10:97869160-97869182 GAAGGACTTGGAGCCATGCCTGG + Exonic
1072820551 10:98552371-98552393 AACGCACTTAGAACTGTGCCTGG + Intronic
1072907693 10:99469929-99469951 AAAGCACTTAAAACAGTGCCTGG - Intergenic
1073411637 10:103346893-103346915 TAAGCACTTAAAACAGTGCCTGG - Intronic
1073591892 10:104765728-104765750 AATGCACTTTGAACTATTCCTGG - Intronic
1073870648 10:107859988-107860010 GTAGCACTTACAACAATTCCTGG + Intergenic
1074013174 10:109505335-109505357 AAAGCACTTAGAATAGTGCCTGG + Intergenic
1074038937 10:109769125-109769147 AAAGCACCTAGCACAATGCCTGG + Intergenic
1074257859 10:111821392-111821414 GAAGCACTTAGAAGAGTGCCTGG + Intergenic
1074307110 10:112289124-112289146 GAAGCACTTAGCACAGTGCCTGG + Intronic
1074363030 10:112838097-112838119 GAAGCACTCAGTACCAGGCCAGG - Intergenic
1074423658 10:113331603-113331625 AAAACACTTAGAACCATGCCTGG - Intergenic
1074486858 10:113892915-113892937 AAAGCACTTAGAACAGTGTCTGG + Intronic
1074736687 10:116441860-116441882 AAAGTGCTTAGAACAATGCCTGG + Intronic
1074752172 10:116597258-116597280 GTAGCACTTAGCACAATGCCTGG - Intronic
1074765924 10:116700015-116700037 AAAGCTCTTAGAGCCATGCCTGG - Intronic
1074891104 10:117737261-117737283 GAAGCACCTAGAACAGTTCCTGG - Intergenic
1074907258 10:117875639-117875661 AAAGAACTTAGAACAGTGCCTGG - Intergenic
1075025589 10:118980900-118980922 GAAGCACTTAGCATAATTCCTGG + Intergenic
1075184905 10:120247307-120247329 GAAGAGCTTAGAACGGTGCCTGG + Intergenic
1075201196 10:120405662-120405684 AAAGCACTTAGAAGAGTGCCTGG - Intergenic
1075270168 10:121042624-121042646 GAAGGACTTAGAACAGTGCCTGG + Intergenic
1075297895 10:121294078-121294100 GCAGCACTTAGCAGTGTGCCTGG + Intergenic
1075641394 10:124067024-124067046 GCTGCACTTAGCACTGTGCCGGG + Intronic
1075750073 10:124761191-124761213 GAAGCACTCAAAATAATGCCTGG - Intronic
1075877196 10:125817653-125817675 GAAGCTCTTAGAATAGTGCCTGG - Intronic
1075971321 10:126656149-126656171 GAAGCATTTAGAATGGTGCCTGG - Intronic
1076651817 10:131994850-131994872 TGAGCACCTAGAACCATGCCTGG + Intergenic
1077004449 11:345944-345966 AAAGCACTTAGTACCATGCTTGG - Intergenic
1077524391 11:3055817-3055839 GAAGGACGTAGAACAGTGCCTGG - Intronic
1077601698 11:3579312-3579334 GAAGCACTTAGCGTTGTGCCTGG - Intergenic
1077651542 11:3977591-3977613 AAAGCACTTAATACAATGCCTGG + Intronic
1077897028 11:6460823-6460845 GAAGCACTTAGAATCATGCCTGG - Intronic
1078045542 11:7911228-7911250 AAAGTACTTAGAGCTATGCCTGG - Intergenic
1078314613 11:10283216-10283238 CTAGCACTTAGCACAATGCCTGG + Intronic
1078407675 11:11085349-11085371 AAAGCACTTAGCACAGTGCCTGG - Intergenic
1078515590 11:12019343-12019365 AAAACACTTAGCAATATGCCTGG + Intergenic
1078519466 11:12051658-12051680 AAAGCACTTTGAACAGTGCCTGG + Intergenic
1078537122 11:12184201-12184223 AAAGCACTTAGAACAGTGGCCGG + Intronic
1078599538 11:12717963-12717985 GAAGGGCTTAGAACCATGTCTGG + Intronic
1078662942 11:13301759-13301781 AAAGCTCTTAGAACCATGCCTGG - Intronic
1078710892 11:13789945-13789967 GAAGCAATTAGAAGTATGTATGG - Intergenic
1078728435 11:13954052-13954074 GAAGCATTTAGACCACTGCCTGG + Intergenic
1078792121 11:14554778-14554800 GAAGTACTTAGAACAATGCCTGG - Intronic
1078848922 11:15146091-15146113 GAAGCATTTAGAACAGTGCCTGG + Intronic
1078952792 11:16153932-16153954 GTAGAACTTAGAATTATGCTTGG - Intronic
1079030765 11:16984777-16984799 CCAGCATTTAGAACAATGCCTGG + Intronic
1079379065 11:19920601-19920623 AAAGCACTTAGTACAGTGCCTGG + Intronic
1079409305 11:20172273-20172295 TAAGCACTTAGAACAGTACCTGG - Intergenic
1079422623 11:20308218-20308240 AAAGCACTTAGAATGCTGCCTGG - Intergenic
1079467893 11:20749456-20749478 CAAGCACATACCACTATGCCTGG - Intronic
1079475009 11:20820989-20821011 CAAGCACTTTGAACAATGCATGG + Intronic
1079896089 11:26120009-26120031 GAAGCATTTAGAAAAATGCCTGG + Intergenic
1080056261 11:27909634-27909656 AAAACACTTAGAACAGTGCCTGG + Intergenic
1080323244 11:31039802-31039824 GAAGCACTTAAAACAGTACCTGG + Intronic
1080407426 11:31991915-31991937 AAAGCACTTGGAACAGTGCCTGG - Intronic
1080514291 11:33005828-33005850 CAAGCACCTAGAACAGTGCCTGG - Intergenic
1080686668 11:34521716-34521738 GAAGCACTTAGCCCAGTGCCTGG + Intergenic
1080691922 11:34565505-34565527 TAAGCACCTAGAATAATGCCTGG - Intergenic
1080710932 11:34747483-34747505 GAAGCACTTAGAGCAGTGCCTGG - Intergenic
1080733626 11:34986925-34986947 GAAGCACTTAGCCCAGTGCCTGG - Intronic
1080775621 11:35383654-35383676 GAAGCATTTAAAACAATGCCTGG + Intronic
1080795523 11:35559608-35559630 CAAGTACCTAGAACGATGCCTGG - Intergenic
1080889413 11:36396616-36396638 CAAGCACTTAGAACTGTACCTGG - Intronic
1080901951 11:36502901-36502923 AAAGCACTTAGAACAGTGCCAGG + Intronic
1080984705 11:37447806-37447828 AAAGCACTTTGAACAATGCCTGG - Intergenic
1081304353 11:41492933-41492955 GAAGCACTCACAACAGTGCCTGG + Intergenic
1081417825 11:42836848-42836870 AAAGCATTTAGAACCATGCCTGG + Intergenic
1081496504 11:43616529-43616551 GAAGCACTTAGAACAATGCCTGG - Intronic
1081906052 11:46670856-46670878 AAAACACTTAGAAAAATGCCTGG - Intronic
1082011063 11:47449767-47449789 GAAGGACTTAGGACAGTGCCCGG + Intergenic
1082740106 11:56901326-56901348 AAAGTGCTTAGAACAATGCCTGG + Intergenic
1082769681 11:57197509-57197531 AAAGTACTTAGAACAGTGCCTGG + Intergenic
1082771143 11:57208459-57208481 AAAGCACTTAGCACAGTGCCTGG + Intergenic
1082796951 11:57384944-57384966 AAAGCTCTCAGAACTATGCCTGG + Intergenic
1082818746 11:57529142-57529164 AAAGCACTTAGCAGGATGCCTGG - Intronic
1083233197 11:61336123-61336145 AAAACACTTAGAACTGGGCCTGG + Intronic
1083956346 11:65985440-65985462 CAGGCACTAAGAACCATGCCCGG - Intergenic
1083980770 11:66166798-66166820 AAAGCACTGAGAACACTGCCTGG - Intronic
1084257605 11:67953859-67953881 GAAGCACTTAGCGTTGTGCCTGG - Intergenic
1084375563 11:68774583-68774605 CAGGCACTTACCACTATGCCCGG + Intronic
1084394485 11:68899850-68899872 AAAGCTCTTAGAACAGTGCCTGG - Intronic
1084815162 11:71641378-71641400 GAAGCACTTAGCATTGTGCCTGG + Intergenic
1085304833 11:75479441-75479463 AAAGCACTTGGAACAATGCCTGG - Intronic
1085439718 11:76548428-76548450 TCAGCACTTAGCACTGTGCCTGG - Intronic
1085743529 11:79096217-79096239 GAAGCACCTAGCACCATGCTGGG + Intronic
1085786838 11:79459720-79459742 AAAGCACTTAAAACAATGCTGGG - Intergenic
1086110366 11:83192638-83192660 AAAGCACTTAGTACAATGCCAGG + Intergenic
1086167839 11:83799997-83800019 AAAGCATTTAGAACAGTGCCTGG + Intronic
1086555192 11:88102031-88102053 AAAGCTCTTAGGACTGTGCCAGG + Intergenic
1086846849 11:91761000-91761022 AAACTGCTTAGAACTATGCCTGG + Intergenic
1087191801 11:95262481-95262503 GAAGCACTTAGAACCATGCCCGG + Intergenic
1087543265 11:99548018-99548040 AAAGCACTTAGAACAGTACCTGG + Intronic
1087658828 11:100961404-100961426 AAAGCACTTAGAAGCATGCTAGG + Intronic
1087672138 11:101119995-101120017 GAAGCAGTTAAAACAGTGCCTGG + Intronic
1087890311 11:103530767-103530789 AAAGCACTTAGAACAGAGCCTGG + Intergenic
1088036626 11:105325013-105325035 AAAGCTCTTAGAACAGTGCCTGG - Intergenic
1088282821 11:108152840-108152862 AAAGCACTTAGATTAATGCCTGG - Intergenic
1088304771 11:108395969-108395991 AAAGCATTTAGAACAATGACTGG + Intronic
1088528117 11:110778521-110778543 TCAGCACTTAGAACCAGGCCTGG - Intergenic
1089083415 11:115796751-115796773 GAGGCACTTAGAACAGTGCTTGG - Intergenic
1089092145 11:115886852-115886874 AAAGCACTGAGCACTTTGCCTGG - Intergenic
1089433771 11:118444978-118445000 TAAGCACTTAGCATTTTGCCTGG + Intronic
1089548753 11:119253270-119253292 AAAGTACTTAGAATAATGCCTGG + Intronic
1089624722 11:119743757-119743779 AAAGCACTTAGTACAGTGCCTGG - Intergenic
1089791539 11:120948539-120948561 GAAGCACTTAGGGCAATACCAGG - Intronic
1090007228 11:123013452-123013474 AAAGCAAATAGAACGATGCCTGG - Intergenic
1090042947 11:123306614-123306636 GCAGCACTTAGCATAATGCCTGG - Intergenic
1090194763 11:124805322-124805344 TCAGCACTTAGAAGAATGCCAGG + Intergenic
1090327163 11:125898971-125898993 AAAGCACATAGAACAATGGCAGG + Intronic
1090641440 11:128732438-128732460 CAAGGACTTAGCACAATGCCTGG - Intronic
1090665231 11:128910699-128910721 CAAGCACTTAGAACACAGCCCGG - Intronic
1090804277 11:130193077-130193099 AAAGCACCGAGAACCATGCCAGG + Intronic
1091002720 11:131923982-131924004 GAAGTACTCAGAACAGTGCCTGG + Intronic
1091080414 11:132661782-132661804 AAAGTTCTTACAACTATGCCTGG - Intronic
1091112835 11:132986530-132986552 TAAGCACCTAGCACTTTGCCTGG + Intronic
1091174819 11:133548436-133548458 GAAGCACTGAGAACAGTGTCTGG + Intergenic
1091194899 11:133722248-133722270 AAAGCACTTAGCACAGTGCCTGG + Intergenic
1091337115 11:134780558-134780580 AAAGCACTTAGAACCTTGTCTGG + Intergenic
1091353696 11:134917791-134917813 GAAGCACTTAGCATGGTGCCGGG + Intergenic
1091424721 12:377124-377146 GAAGCACTTAGACCTCTTCCAGG + Intronic
1091578680 12:1765516-1765538 AAAGCACTTAGTACAATGTCTGG + Intronic
1091592491 12:1852975-1852997 TAAGCACTCAGAACAGTGCCTGG + Intronic
1091758757 12:3073456-3073478 AAAGTACTTAGAACTGTGCCTGG + Intergenic
1091959789 12:4683835-4683857 CAAGCCCCTAGAACAATGCCTGG + Intronic
1092427839 12:8388681-8388703 GAAGCACTTAGCGTTGTGCCTGG - Intergenic
1092429111 12:8395668-8395690 GAAGCACTTAGCGTTGTGCCTGG - Intergenic
1092699199 12:11208579-11208601 AAATCACTTAGAACAGTGCCTGG - Intergenic
1092748786 12:11698803-11698825 GAAGCTCTTAGCACAGTGCCTGG - Intronic
1092896075 12:13011543-13011565 AAAGCACTTAGAACAGGGCCTGG + Intergenic
1092899170 12:13042716-13042738 AAAGCACTTACAACAGTGCCTGG - Intergenic
1092970462 12:13689328-13689350 GAAGCACTTGGAAAGGTGCCTGG + Intronic
1093241334 12:16679848-16679870 GAAGTACTTAGAAGAATGCAAGG - Intergenic
1093256791 12:16877854-16877876 CAAGCATTTAGAACATTGCCTGG + Intergenic
1093384804 12:18539314-18539336 AAAGCACTTAGCACAATGCCTGG - Intronic
1093516419 12:19992050-19992072 AAAGCCCTTAGAACAGTGCCTGG - Intergenic
1093850434 12:24029941-24029963 GAAGCAGTGAGAACTGAGCCTGG - Intergenic
1093862113 12:24178737-24178759 GTAGCATATAGAACAATGCCTGG - Intergenic
1093878560 12:24377802-24377824 CAAACACTTAGAACCATCCCTGG + Intergenic
1093889028 12:24497486-24497508 GAAACACTGAGAATGATGCCTGG - Intergenic
1093936271 12:25004079-25004101 GAAGAGCTTAGTACCATGCCTGG + Intergenic
1094023573 12:25940041-25940063 TGAGCACTTAGAACAGTGCCTGG + Intergenic
1094070301 12:26405273-26405295 GAAGAACTTAGAACAGTGCTTGG + Intronic
1094117758 12:26936346-26936368 GAAGCACTTTGAAATATGTCTGG + Intronic
1094147981 12:27250546-27250568 AAAGTACTTAGCACTATGTCTGG - Intronic
1094198679 12:27776251-27776273 AAAGCACTTACAACAGTGCCTGG + Intergenic
1094337706 12:29379623-29379645 AAAGCATTTAGAACAATACCTGG - Intronic
1094474770 12:30832764-30832786 GAAGCACTCAGCACAATGCCCGG - Intergenic
1095119546 12:38400477-38400499 CAAGCACTTAGAATAATGCTTGG - Intergenic
1095257038 12:40050934-40050956 AAAGCACTTAAAATTGTGCCTGG + Intronic
1095390184 12:41696770-41696792 CAAGCACCTAGAACTCTGCCTGG + Intergenic
1095508991 12:42928872-42928894 ACAGAACTTAGAACCATGCCTGG - Intergenic
1095574791 12:43724472-43724494 GAAACACTAAGAACAATGTCTGG - Intergenic
1095812952 12:46390595-46390617 GAAGCACTTAGAACCATGCCTGG + Intergenic
1095825200 12:46523859-46523881 GAAGCTCTTAGCACACTGCCTGG + Intergenic
1095827591 12:46546412-46546434 AAAGCACTTAGCAGTACGCCAGG - Intergenic
1095841856 12:46702139-46702161 TAAACAATTAGAACTGTGCCTGG - Intergenic
1096000894 12:48129355-48129377 GAAAAACTTAGAACTAGGGCTGG - Intronic
1096240964 12:49960200-49960222 GAAGCCCTTAGCACAGTGCCTGG - Intergenic
1096405169 12:51338756-51338778 TTAGCACTTAGCACAATGCCTGG + Intronic
1096539652 12:52298558-52298580 AAATCACTGAGAACTAAGCCTGG - Intronic
1096559770 12:52427631-52427653 AAAGCTCTTAGAACAATGCATGG - Intronic
1096759792 12:53831416-53831438 GAAAGGCTTAGAACAATGCCTGG - Intergenic
1097109627 12:56648637-56648659 GAAGCATTGAGAACAATGCCTGG + Intergenic
1097535337 12:60862783-60862805 AAAGCACTTAGAATAATTCCTGG - Intergenic
1097640613 12:62177048-62177070 GAAGTACTTAGCACAGTGCCTGG + Intronic
1097686441 12:62695429-62695451 GAGGTACTTAGCACTGTGCCTGG + Intronic
1097720411 12:63013828-63013850 AAAATGCTTAGAACTATGCCTGG - Intergenic
1097768681 12:63554633-63554655 GAAGCACTTAGCAATGAGCCTGG - Intergenic
1097785037 12:63749673-63749695 GAAGCACTTAGCAATGAGCCTGG - Intergenic
1097924204 12:65109853-65109875 AAAGCACTTAGAAGAGTGCCCGG + Intronic
1097942518 12:65327263-65327285 GAGGGACTTGGCACTATGCCAGG + Intronic
1097995439 12:65882711-65882733 AAAGCACTTGGCACAATGCCTGG + Intronic
1098197693 12:68019288-68019310 GAGGCACTTAGAACAGAGCCTGG - Intergenic
1098225102 12:68313132-68313154 CCAGCACTTAAAACAATGCCTGG + Intronic
1098328023 12:69322839-69322861 GAAGCATGTAGTAATATGCCAGG + Intergenic
1098499663 12:71176915-71176937 GAAGCATTTAGAACAATTACAGG - Intronic
1098541815 12:71665200-71665222 AAAGCACTTTGAACAATGCCTGG + Intronic
1098557666 12:71837967-71837989 GAAGCCCTTAGCACAGTGCCAGG - Intergenic
1098571370 12:71991381-71991403 GAAGCATTTAGCACAGTGCCTGG + Intronic
1098994357 12:77101096-77101118 AAAGCATTTAGAACATTGCCTGG + Intergenic
1099166512 12:79313833-79313855 AAAGCACTTAGAACAATACTTGG + Intronic
1099234477 12:80067620-80067642 AAAGCACTTAGAACAGTGCCTGG - Intergenic
1099363166 12:81731843-81731865 AAAGTCCTTAAAACTATGCCTGG + Intronic
1099420418 12:82451500-82451522 AAAGTACTTACAACAATGCCTGG + Intronic
1099468098 12:83011412-83011434 AAGGCACTTAGAACAATGTCTGG + Intronic
1099639705 12:85270714-85270736 AAAGCATTTAGAACAGTGCCTGG - Intergenic
1099734033 12:86543535-86543557 AAAGTACTTAGTACTATACCTGG - Intronic
1099863626 12:88250665-88250687 AAAGCACTTAGCACAATGCTTGG - Intergenic
1099975083 12:89538125-89538147 AAAGCACTTAGTACAGTGCCTGG + Intergenic
1100012116 12:89966184-89966206 TAAGCACTCAGAACAATGTCTGG - Intergenic
1100389834 12:94138895-94138917 AAAGCATTTAGCACAATGCCTGG - Intergenic
1100405194 12:94266788-94266810 AAAGCACTTAGAACATTGCCAGG + Intronic
1100461689 12:94805877-94805899 CTAACACTTAGAACAATGCCTGG + Intergenic
1100601847 12:96118469-96118491 AAAGCACTTAAAACAATGCCTGG - Intergenic
1100637298 12:96447105-96447127 GAGGCACGTACCACTATGCCCGG + Intergenic
1100797158 12:98194580-98194602 AGAGCACTTAGCACCATGCCTGG + Intergenic
1100880084 12:99006779-99006801 AAAGTACTTAGAACAGTGCCTGG - Intronic
1100885924 12:99070059-99070081 GAAGTACTTAGAATAGTGCCTGG + Intronic
1100931260 12:99612354-99612376 AAAGTGCTTAGAACTGTGCCTGG - Intronic
1100945265 12:99776313-99776335 AAAACACTTAGAACAATGCTGGG - Intronic
1101088247 12:101258029-101258051 GAAGACCTTAGAACATTGCCTGG - Intergenic
1101227355 12:102702844-102702866 GAATCACTTAGTACATTGCCTGG - Intergenic
1101229741 12:102727998-102728020 CAAGTACTTAGAACAGTGCCTGG + Intergenic
1101288847 12:103345348-103345370 AAAGCACTTAGAAGAGTGCCTGG + Intronic
1101293000 12:103390243-103390265 AAAACGCTTAGAACTTTGCCTGG - Intronic
1101320259 12:103667340-103667362 AAAGCATTTAGAACAATGTCTGG - Intronic
1101334959 12:103788725-103788747 GAATCACTCAGAACTGTGCCAGG + Intronic
1101726787 12:107394726-107394748 AAAGCATTTAGAACAATGCCTGG + Intronic
1101728345 12:107406195-107406217 GAAGTGCTTAGAACAGTGCCTGG + Intronic
1101751007 12:107582249-107582271 AAAGCACTTAGAACAGTGCTCGG - Intronic
1101793701 12:107953818-107953840 CAAGCACTTAGAATAGTGCCTGG - Intergenic
1102294916 12:111729003-111729025 AAAGCCCTTAGAACTATTCTTGG - Intronic
1102399458 12:112615875-112615897 GAAGCCCTTAGAATGACGCCTGG + Intronic
1102422224 12:112812991-112813013 AAAGTGCTTAGAACAATGCCTGG - Intronic
1102455587 12:113069088-113069110 GAAGCATTTAGAACAGCGCCTGG + Intronic
1102465037 12:113124727-113124749 AAAGCGCTTAGCACCATGCCTGG + Intronic
1102467151 12:113136382-113136404 AAAGCGCTTAGAACAGTGCCTGG - Intergenic
1102555100 12:113721727-113721749 AAAGCACTTAGCACAATGCTGGG - Intergenic
1102727208 12:115076185-115076207 GAAGCACGTAGAACTATACAAGG + Intergenic
1102779077 12:115547883-115547905 GAAAGACTTAGAATTGTGCCTGG - Intergenic
1102927594 12:116838305-116838327 GAAGCATTTAGAACTGCTCCTGG + Intronic
1103139887 12:118539394-118539416 AAAGCACTTAGCACAGTGCCTGG + Intergenic
1103187684 12:118974900-118974922 AAAGTACTTAGAAAAATGCCTGG + Intergenic
1103256513 12:119546145-119546167 GAAGCACTTAGAACAATGCGTGG - Intergenic
1103294389 12:119873962-119873984 AAAGCACTTAGCACCTTGCCTGG - Intronic
1103572207 12:121852577-121852599 ATAGCACTTAGAACAGTGCCTGG - Intronic
1103857952 12:123987451-123987473 GAAGTACTTAAAACACTGCCTGG - Intronic
1103921218 12:124400200-124400222 GAAGCACCTAGAACAGTGCCTGG - Intronic
1103979967 12:124730726-124730748 GAAGCACTGGGCACTGTGCCAGG + Intergenic
1104071825 12:125352593-125352615 AAAGTTCTTAGAACAATGCCTGG + Intronic
1104096716 12:125565033-125565055 AAAACACTTGGAACAATGCCTGG - Intronic
1104275723 12:127325658-127325680 GAAGCACTTAAAATCATACCTGG - Intergenic
1104542828 12:129683405-129683427 TAAGCACTTAGAACAGTGCTTGG + Intronic
1104715319 12:131012539-131012561 GAAGCACGCAGAATTATTCCTGG - Intronic
1104827353 12:131722602-131722624 GAAGCACTTAGTACACTGTCTGG - Intronic
1105553503 13:21422078-21422100 AAAACACTTAGAAGGATGCCTGG + Intronic
1105893264 13:24697262-24697284 ACAGCACTTAGAACAGTGCCTGG + Intronic
1105964948 13:25375229-25375251 CTAGCACCTAGAACCATGCCGGG - Intronic
1106102130 13:26704068-26704090 AAGGCAGTTAGAACAATGCCTGG - Intergenic
1106106899 13:26741114-26741136 AAAGCACTTAGCACTTTGCCTGG + Intergenic
1106139146 13:26996893-26996915 AAAGCACTTAGCATTTTGCCTGG + Intergenic
1106298571 13:28440795-28440817 AAAGCACTTAGAATGATGCCTGG + Intronic
1106465529 13:30011058-30011080 GCAGCACTTAGCACTGTGCTTGG + Intergenic
1106619965 13:31363511-31363533 GAAGCACTTTAAACTCTTCCAGG + Intergenic
1106805248 13:33299777-33299799 CAAGCACCAAGAACTTTGCCTGG - Intronic
1106881426 13:34135877-34135899 AAAGCACTTAGCAGTATGCTTGG - Intergenic
1106924465 13:34599851-34599873 AAAGCCCTTAGATCCATGCCTGG - Intergenic
1107092547 13:36497882-36497904 AAAGTTCTTAGAACAATGCCTGG + Intergenic
1107183770 13:37493499-37493521 GAAGCACATAGAACATTGCTTGG + Intergenic
1107395617 13:40013713-40013735 GAAACACTTAGCACCGTGCCTGG + Intergenic
1107438261 13:40401290-40401312 AAAGCACTTAGAAGAGTGCCTGG - Intergenic
1107501298 13:40979275-40979297 AAAGCTTTTAGAACTATGTCTGG - Intronic
1107632813 13:42359636-42359658 AAATCCCTTAGAACAATGCCTGG + Intergenic
1107925267 13:45254482-45254504 GAAGCACTCAGACCAATACCTGG - Intronic
1108242667 13:48482906-48482928 CTAGCATTTAGAACTGTGCCTGG - Intergenic
1108343261 13:49518558-49518580 AAAGCACTTAGAACTATGCCTGG - Intronic
1108390188 13:49939815-49939837 AAAACACTTAGAACAGTGCCTGG - Intergenic
1108799971 13:54082807-54082829 CAAGTACTTAGAATAATGCCTGG + Intergenic
1108918615 13:55648676-55648698 GAAAAACTTAGCACTGTGCCTGG - Intergenic
1109694605 13:65937453-65937475 TAAGCATTTGGAACCATGCCTGG - Intergenic
1110147231 13:72206288-72206310 CAAGCACATAGAAGAATGCCTGG + Intergenic
1110287967 13:73772233-73772255 TAAGAACTTAGAACAGTGCCTGG - Intronic
1110446870 13:75594619-75594641 TCAGCACTTAGCACAATGCCTGG - Intronic
1110594810 13:77308538-77308560 GTCACACTTAGAATTATGCCTGG + Intronic
1110686733 13:78384385-78384407 GAAGTACTTAGAATAGTGCCTGG - Intergenic
1111212309 13:85095282-85095304 GAAGCACTTAGGACAATGTCTGG + Intergenic
1112114836 13:96340480-96340502 GAAGCACTTAGCAGAACGCCTGG + Intronic
1112190254 13:97170284-97170306 GAAGCACTTAGCAAAATGACTGG - Intergenic
1112196070 13:97227702-97227724 GAAAAACTTAGAACTGTCCCTGG + Intronic
1112262708 13:97892045-97892067 GAAGCTCTTAGCATAATGCCAGG - Intergenic
1112375719 13:98838330-98838352 GAAGCTCTTGGAACAGTGCCTGG + Intronic
1112590371 13:100758289-100758311 TAAGCCCTTAGAGCAATGCCTGG + Intergenic
1112725133 13:102294895-102294917 ATAGCACTTAGAACAATGTCTGG + Intronic
1113108547 13:106797576-106797598 TAAACACATAGAACTGTGCCTGG - Intergenic
1113130495 13:107031370-107031392 CAAGCACTTAGGACAGTGCCTGG + Intergenic
1113351645 13:109535361-109535383 CAAGAACTTAGAACAGTGCCTGG - Intergenic
1113856659 13:113450035-113450057 GAAGCAGCTGGAACAATGCCTGG + Intronic
1114168386 14:20245634-20245656 AGAGCACTTAGAACTATGCCTGG + Intergenic
1114351220 14:21853619-21853641 GAAGGACTTAGAAAAATGTCAGG + Intergenic
1114563693 14:23612207-23612229 AAAGTACTTAGAACAGTGCCTGG + Intergenic
1114622751 14:24106957-24106979 AAAGCACTCAGAACTATGCCTGG + Intronic
1114662382 14:24355524-24355546 GAAGCACTTAGAGGAGTGCCTGG + Intergenic
1114841444 14:26267347-26267369 GAAGCCCTCAAAACTATGCCTGG - Intergenic
1114857260 14:26463921-26463943 GAAGTATTTAGAACACTGCCTGG - Intronic
1115053994 14:29099978-29100000 GAAGCACTTGGAACAGTGCCTGG - Intergenic
1115166015 14:30449311-30449333 GAAGCACTTATAACAGTCCCTGG - Intergenic
1115431995 14:33329840-33329862 GAAGTGCTTAAAACAATGCCTGG + Intronic
1115453173 14:33572416-33572438 AAAGTACTTAGAACAGTGCCTGG - Intronic
1115713014 14:36071216-36071238 GAAATGCTTAGAACAATGCCTGG - Intergenic
1115782315 14:36783372-36783394 GAAGCAGTTAGTACCATGCATGG + Intronic
1116473266 14:45309929-45309951 AAAGCTCTTAAAACAATGCCTGG - Intergenic
1116541128 14:46103153-46103175 AAAGCACTTAGAAGAGTGCCTGG - Intergenic
1116957056 14:50935549-50935571 AAAGCATTTAGAACTATTCTTGG + Intronic
1116967990 14:51034269-51034291 GAAGCACTTAGAAGTGGTCCTGG - Intronic
1117116802 14:52522295-52522317 AAAGTGCTTAGTACTATGCCTGG - Intronic
1117220807 14:53603574-53603596 AAAGCACTTAGAATAGTGCCTGG - Intergenic
1117263183 14:54057941-54057963 AAAGCACTTAGAACATTACCTGG - Intergenic
1117321547 14:54628645-54628667 CAAGTACTTAGTACAATGCCTGG - Intronic
1117511298 14:56454283-56454305 AAAGTGCTTAGAACCATGCCTGG + Intergenic
1117524298 14:56581633-56581655 AAAGCACTTGGAACAGTGCCTGG - Intronic
1117564614 14:56980213-56980235 GAAGCAGATAGATTTATGCCAGG - Intergenic
1117592565 14:57287839-57287861 AAAACACTTAGAACTTTGCCTGG - Intronic
1117704055 14:58444718-58444740 TAAGCACTTAAAAATATGGCTGG - Intronic
1117741482 14:58823615-58823637 CAAGCACTTCGAACAGTGCCTGG + Intergenic
1117973107 14:61271714-61271736 AAAGCACTCAGAACATTGCCTGG + Intronic
1117993857 14:61460509-61460531 AAAGCACTTAGAACAATGTGTGG - Intronic
1118258945 14:64229792-64229814 GAGGCACTGAGAACTGTGTCTGG + Intronic
1118453981 14:65928999-65929021 GAAGCACTTAGAACAGTGCCTGG - Intergenic
1118624101 14:67641546-67641568 TAAGCAGCTAGAACAATGCCTGG + Intronic
1118638544 14:67770683-67770705 AAAGCACTTAGTATCATGCCTGG + Intronic
1118689583 14:68325261-68325283 AAAACACTTAGCACAATGCCTGG + Intronic
1118775068 14:68968818-68968840 AAAGCACTTAGACATGTGCCTGG + Intronic
1118908270 14:70039289-70039311 AAAACACTGAGAACTATTCCAGG + Intergenic
1118935340 14:70282956-70282978 AAAGCATTCAGAACAATGCCTGG - Intergenic
1118968451 14:70610505-70610527 AAAGCACTTAGGACTGTGCCTGG - Intergenic
1119119559 14:72061917-72061939 GCAGCATTGAGAGCTATGCCTGG - Intronic
1119274425 14:73340581-73340603 GCAGTACTTAGAACATTGCCTGG + Intronic
1119276998 14:73366482-73366504 AAAGCATTTACAACAATGCCTGG - Intronic
1119427365 14:74544447-74544469 AAAGCACTTAGCACCGTGCCTGG + Intronic
1119646701 14:76353533-76353555 AAAGCACTTAGAACAGTGCCTGG - Intronic
1119657492 14:76427720-76427742 AAAGAGCTTAGAACAATGCCTGG - Intronic
1119716206 14:76861246-76861268 GAAGTGCTTAGAAGGATGCCTGG + Intronic
1119870227 14:78010819-78010841 GAAGCACTTGGAACAGTGCCTGG + Intergenic
1120152328 14:81050570-81050592 GAAGCACTTATAACAATGTTAGG - Intronic
1120237279 14:81906447-81906469 AAAGCACTTAGCACAATGCCTGG + Intergenic
1120250320 14:82055015-82055037 AAAGCTCTTAGAACAGTGCCTGG + Intergenic
1120510889 14:85413163-85413185 GAAACACTTAGAAAAGTGCCTGG - Intergenic
1120941307 14:89952833-89952855 GAAGCACTCAGAGCTCAGCCTGG - Intronic
1121002630 14:90463372-90463394 GGAGCTCTTAGAACATTGCCTGG - Intergenic
1121044086 14:90775283-90775305 AAAGCACTTAGCACAATGCCCGG - Intronic
1121601431 14:95207538-95207560 GAAGTACCTAGTACTGTGCCTGG - Intronic
1122633702 14:103120195-103120217 AAAACACTTAGAACAACGCCTGG + Intergenic
1123693085 15:22855497-22855519 CCAGCACCTAGAACAATGCCTGG - Intronic
1124179860 15:27462318-27462340 GCAGCATTTAGAAATGTGCCAGG + Intronic
1124640597 15:31393742-31393764 CCAGCACTCAGAACGATGCCTGG - Intronic
1124809219 15:32917533-32917555 AAAACACTTAGAACAATGCCTGG - Intronic
1125224880 15:37384569-37384591 AAAGTACTTAGAACAATGCCTGG + Intergenic
1125252538 15:37721942-37721964 GAAGCCCTCAGCACTGTGCCTGG + Intergenic
1125317338 15:38445197-38445219 GAAGCAGTTAAGACTATGCCTGG + Intergenic
1125381781 15:39093398-39093420 AAAGCAGTTAGCACTCTGCCTGG - Intergenic
1125439297 15:39684811-39684833 AAAGCACTTAGAACAGTGTCAGG - Intronic
1125539381 15:40460991-40461013 AAAGCACTCAGAACAGTGCCTGG - Intronic
1125598382 15:40901921-40901943 AAAGTACTTAGAACACTGCCTGG + Intronic
1125810494 15:42536380-42536402 AAAGCACTTAGAACAGTTCCTGG + Intronic
1126015073 15:44342993-44343015 AAAACACTTAGAACAGTGCCTGG + Intronic
1126338875 15:47617803-47617825 TAAACACTTAGAACATTGCCTGG + Intronic
1126775129 15:52093979-52094001 AAAGCACTTAGAACACCGCCTGG - Intergenic
1126810266 15:52395532-52395554 CTTGCACTTAGAACTGTGCCTGG + Intronic
1126822215 15:52515511-52515533 GAAGCACTTAGAATAATGCCTGG - Intronic
1126917330 15:53480460-53480482 GTAGCACTTAGATTTATGCCTGG - Intergenic
1126955300 15:53927055-53927077 AAAGCTCTTAGAACAGTGCCTGG - Intergenic
1127010218 15:54617556-54617578 GAAGCACTTAGCACAATGCCTGG + Intronic
1127028170 15:54831459-54831481 AAAGAACTTAGAACAGTGCCTGG + Intergenic
1127044879 15:55015057-55015079 AAAGCACTTAGAACAGTGCCTGG - Intergenic
1127345654 15:58095150-58095172 AAAGCACTTAAAATAATGCCTGG - Intronic
1127530968 15:59843267-59843289 CAAGCAATGAGAACAATGCCAGG - Intergenic
1127586149 15:60380204-60380226 GAAGCATTTAGCACGATGCCTGG - Intronic
1127824954 15:62695013-62695035 AAAGCACATAAAACAATGCCTGG + Intronic
1128039339 15:64556450-64556472 GAAGCATTTAGAATAATGGCTGG - Intronic
1128101178 15:65001278-65001300 GAAGCACTTATAATTACTCCAGG - Intergenic
1128122334 15:65161078-65161100 AAAACACTTAGAACAATACCTGG + Intronic
1128168648 15:65490560-65490582 AAAGCACTTAGAACAAAGCCTGG + Intronic
1128421042 15:67491846-67491868 CCAGCACCTAGAACTGTGCCTGG - Intronic
1128437711 15:67671329-67671351 TAAGCACCTAGAACAGTGCCTGG - Intronic
1128675026 15:69602298-69602320 GAAGCAGATAGAAGGATGCCAGG - Intergenic
1128829433 15:70753643-70753665 CTAGCACTTAGAACAATGCCTGG + Intronic
1128874550 15:71191492-71191514 GATGTACTTAGCACTATGCCTGG - Intronic
1128915930 15:71562475-71562497 GAACCACTTTGAATAATGCCTGG - Intronic
1129060238 15:72855243-72855265 CAAGCACCTAGAACAGTGCCTGG + Intergenic
1129204923 15:74031765-74031787 GAAGCACTTAGCACTGTGCCTGG + Intronic
1129238095 15:74235658-74235680 AAAGCACTTAGGACCCTGCCTGG + Intergenic
1129534499 15:76301122-76301144 AAAGCTCTTAGAATGATGCCTGG + Intronic
1130010758 15:80151912-80151934 GAAGCACCTAGAATAGTGCCTGG - Intergenic
1130046096 15:80446049-80446071 AAAGCACTTAGAATGATGCCTGG - Intronic
1130130622 15:81138751-81138773 GAAGCATTTACAACACTGCCTGG - Intronic
1130369745 15:83275061-83275083 GTAGAATTTAGAACAATGCCTGG - Intronic
1130566634 15:85001875-85001897 AAAGTACTTAGAACAGTGCCTGG - Intronic
1130718711 15:86364298-86364320 AAATCACTTAGCACAATGCCTGG - Intronic
1130853110 15:87817381-87817403 AAAGCATCTAGCACTATGCCTGG - Intergenic
1131020115 15:89090344-89090366 GAAGCATTTAGAACAGTACCTGG + Intronic
1131197213 15:90365176-90365198 ACAGCACTTAGAACAGTGCCTGG + Intronic
1131310905 15:91289179-91289201 CAAGCACCTAGAACAATGTCTGG + Intronic
1131527774 15:93166346-93166368 AAAGCACTTAGGACAATGCCAGG - Intergenic
1131743021 15:95414724-95414746 AAAGCACTTAGAACACAGCCTGG - Intergenic
1132147940 15:99439476-99439498 CCAGCACTTAGAACAATGCCTGG - Intergenic
1132271991 15:100534397-100534419 AAAGCACTTAGAACAATACCTGG + Intronic
1132272029 15:100534839-100534861 AAAGCACTTAGAACAATACCTGG - Intronic
1133053644 16:3133920-3133942 CAAGCACCTAGAATTGTGCCTGG - Intronic
1133370403 16:5241690-5241712 GAAGCACTTAGCGTTGTGCCTGG + Intergenic
1133425003 16:5680818-5680840 CTAGCATTTAGAACTATGCCTGG - Intergenic
1133667721 16:7985967-7985989 AAAGCACTGAGAACAGTGCCTGG - Intergenic
1133811265 16:9162763-9162785 GAAGCATCTGGAACAATGCCTGG + Intergenic
1134171014 16:11969827-11969849 GAAGCACTTAGAACAGTCCCTGG - Intronic
1134241055 16:12507244-12507266 AAAGCACTTAGCACGGTGCCTGG + Intronic
1134271322 16:12735698-12735720 AAAGAGCTTAGAACAATGCCTGG + Intronic
1134317658 16:13134291-13134313 AAAGCACATAGCACAATGCCTGG + Intronic
1134340852 16:13344376-13344398 GCAGCACTTGGAACCATTCCTGG - Intergenic
1134413563 16:14023740-14023762 AAAGCACTTAGAACTGTGCCTGG + Intergenic
1134657190 16:15955866-15955888 CCAGCACCTAGAACTGTGCCTGG + Intronic
1134688765 16:16177240-16177262 GAAGCACTTAGCACAACCCCTGG + Intronic
1134694252 16:16211442-16211464 AAAGCACTTAGAACAGGGCCTGG - Intronic
1134757393 16:16680008-16680030 AAGACACTTAGCACTATGCCTGG + Intergenic
1134757613 16:16682152-16682174 AAAGCACTTAGAACAGTACCTGG + Intergenic
1134814022 16:17191206-17191228 AAAGCACTTAGAATAATGCTAGG + Intronic
1134869177 16:17636376-17636398 AAAGTACTTAGAGCTGTGCCTGG + Intergenic
1134977585 16:18583188-18583210 AAAGCACTTAGAACAGGGCCTGG + Intergenic
1134988455 16:18677014-18677036 AAAGCACTTAGAACAGTACCTGG - Intergenic
1135091094 16:19518362-19518384 AAAGCACTTAGAAGAGTGCCTGG - Intronic
1135157821 16:20069197-20069219 TAAGCACTGAGCACAATGCCTGG - Intronic
1135163828 16:20121356-20121378 AAAGTGCTTAGAACTGTGCCTGG + Intergenic
1135196340 16:20398132-20398154 GAAGCACTTAGGACAGTGCCAGG + Intronic
1135350190 16:21722813-21722835 GAAGCACTTAGAATAGTACCTGG + Intronic
1135397337 16:22141341-22141363 AAAGCACTTAGCACAATGCCAGG + Intronic
1135984458 16:27173823-27173845 AAAGCACTTAGAATTGTGCCTGG + Intergenic
1136018742 16:27426050-27426072 AAAGCATTTAGAACAGTGCCTGG - Intronic
1136175533 16:28513899-28513921 AAAGCACTTAGAACAGGGCCTGG + Intergenic
1136555325 16:31004267-31004289 GGAGCACATAGAACAGTGCCTGG - Intronic
1136595528 16:31246645-31246667 TAATCACTTAGAACCATGTCTGG + Intergenic
1136616057 16:31399279-31399301 AAAGCACTTGGAACCCTGCCTGG + Intronic
1137341071 16:47606035-47606057 GAAATACTTAAAACAATGCCTGG + Intronic
1137368021 16:47877607-47877629 TCAGCACCTAGAACCATGCCTGG + Intergenic
1137487365 16:48902785-48902807 AAAGCACTTAGAACAGTACCTGG - Intergenic
1137512422 16:49113387-49113409 CCAGCACTTAGAACAGTGCCTGG - Intergenic
1137599682 16:49748154-49748176 GAAGCACCTAGAACAGTGCCTGG + Intronic
1137735995 16:50723811-50723833 GGAGCACTTACAAATATGCCAGG - Intronic
1137799333 16:51247939-51247961 GAAGCACTGAGAATAATGCCTGG + Intergenic
1137880032 16:52036407-52036429 AAACTGCTTAGAACTATGCCTGG + Intronic
1138085051 16:54125941-54125963 GAAGCACTCACAACTTTGCCTGG - Intergenic
1138364108 16:56458633-56458655 AAAGCACTTACTACTCTGCCTGG - Intronic
1138451534 16:57096014-57096036 CCAGCACTTAGAACAGTGCCTGG + Intronic
1138463288 16:57166832-57166854 GAAGCACTTAACACAATGCCTGG + Intronic
1139068149 16:63345111-63345133 GAAGTACTTAGAAAAATACCTGG + Intergenic
1139315400 16:66063384-66063406 AAAGCTCTTAGGACAATGCCCGG - Intergenic
1139333968 16:66217877-66217899 AAATCACTTAGAACATTGCCTGG + Intergenic
1140445813 16:75026970-75026992 TAAGCATTTAGAACTGTGCCGGG - Intronic
1141077634 16:81021895-81021917 CAAGCACTCACCACTATGCCTGG + Intronic
1141101623 16:81201724-81201746 AAAGCACTTAGAACAGTGCCTGG + Intergenic
1141325434 16:83053115-83053137 GAGGCTCTTAGAAAGATGCCTGG + Intronic
1203139609 16_KI270728v1_random:1752701-1752723 AAACCACTAAGAACAATGCCTGG + Intergenic
1143043104 17:4054291-4054313 CTAGCACTTAGTACAATGCCTGG - Intronic
1143052078 17:4134577-4134599 GAAGGGCTTAGAACTCTGCCTGG - Intronic
1143187942 17:5021854-5021876 GGAGTACTTAGAACCATGGCCGG - Intronic
1143241083 17:5443841-5443863 AAAGTACCCAGAACTATGCCTGG - Exonic
1143401641 17:6649363-6649385 GAAGCATTTAGCACTGTTCCTGG + Intronic
1143441415 17:6977348-6977370 AAAGCACTTAGAAAAATGTCTGG + Intronic
1143751207 17:9029230-9029252 AAAGCACCTAGGACAATGCCTGG - Intronic
1143826134 17:9609186-9609208 TAAGCACCTAGAATGATGCCTGG - Intronic
1143913825 17:10274399-10274421 AAAGCACCTAGAACTGTGTCCGG - Intergenic
1144168095 17:12632192-12632214 AAAGCACTTAGAACAGTGCCTGG - Intergenic
1144838886 17:18173522-18173544 AGAGCACTTAGAACAGTGCCTGG + Intronic
1145076878 17:19862877-19862899 CCAGCACTCAGAACAATGCCTGG + Intronic
1145281835 17:21473646-21473668 GAAGACCTTAGAACAATGCCTGG - Intergenic
1145304492 17:21665894-21665916 GAAGTACTTCGCACAATGCCTGG - Intergenic
1145395612 17:22491973-22491995 GAAGACCTTAGAACAATGCCTGG + Intergenic
1145867895 17:28252529-28252551 CAAGCACCTAGAACAGTGCCTGG + Intergenic
1146192841 17:30785431-30785453 GTAGAATTTAGAACAATGCCTGG + Intronic
1146280522 17:31541457-31541479 AAAGCACTTGGAACACTGCCTGG - Intergenic
1146356341 17:32137618-32137640 AAAACACTTAGAATTGTGCCTGG - Intergenic
1146483862 17:33227665-33227687 AAAGCTCTTAGAACAATGCCTGG - Intronic
1146524401 17:33553687-33553709 AAAGCACATAGTACCATGCCTGG - Intronic
1146570634 17:33949792-33949814 AAAGCACTTAGCACACTGCCTGG + Intronic
1146590483 17:34124213-34124235 AAAGCACTTAGCACAGTGCCTGG + Intronic
1146701418 17:34963807-34963829 AAAGCACTTAGAACCATGCCTGG - Intronic
1146772647 17:35582871-35582893 AAAGCACTTAGAACTATGGCTGG - Intronic
1147333177 17:39710828-39710850 AAAGCTCTTAGAACGGTGCCTGG + Intronic
1147333730 17:39714547-39714569 AAAGCTCTTAGAACAGTGCCTGG + Intronic
1147497198 17:40928031-40928053 GAACTACTTAGCACAATGCCTGG + Intronic
1147554646 17:41469067-41469089 CAAGCACTCAGCACCATGCCTGG - Intergenic
1147734838 17:42629546-42629568 TCAGCACTTAGCACAATGCCTGG - Intergenic
1148017794 17:44534588-44534610 AAAGAACTTAGATCAATGCCTGG - Intergenic
1148162125 17:45456320-45456342 CCAGCACTTAGAACAGTGCCTGG + Intronic
1148235896 17:45968847-45968869 AAAGCACTTTGTACCATGCCTGG - Intronic
1148718834 17:49735863-49735885 GAATGATCTAGAACTATGCCAGG - Intronic
1148961644 17:51398084-51398106 AAAGCACCTAACACTATGCCTGG - Intergenic
1149006052 17:51806569-51806591 CTAGCACTTGGCACTATGCCTGG + Intronic
1149008639 17:51832044-51832066 GAAGCACCTAGAAGTTGGCCTGG - Intronic
1149085676 17:52712871-52712893 AAAGAACTTAAAACAATGCCTGG - Intergenic
1149174000 17:53847569-53847591 GAAGCAGTTACGAATATGCCAGG - Intergenic
1149211546 17:54308183-54308205 GAAGAACTTAGTCTTATGCCTGG + Intergenic
1149375874 17:56043375-56043397 GAAGCACTTAGAACAGAGCCTGG - Intergenic
1149599387 17:57883767-57883789 AAAGCACTTAGGATGATGCCTGG + Intronic
1149605238 17:57919982-57920004 GAAGCACTTAGTCCAGTGCCTGG - Intronic
1149620136 17:58038194-58038216 GAAGCCCTTAGCACAATGCTTGG - Intergenic
1149875924 17:60232932-60232954 GAAGCACTTAGCCCAGTGCCTGG - Intronic
1150183550 17:63154629-63154651 AAAGCACTTAGAAGAATGCTTGG + Intronic
1150393361 17:64802968-64802990 CCAGCACTTAGAACAGTGCCTGG + Intergenic
1150471516 17:65441443-65441465 GAACCACTTAGGACAGTGCCTGG - Intergenic
1150511077 17:65753742-65753764 AAAGCACTTAGAACAGTGCCTGG - Intronic
1150556751 17:66261593-66261615 AAAGCACTTAGCACGATGCCTGG - Intergenic
1150932004 17:69595356-69595378 GAAGCACCTTGCACAATGCCTGG - Intergenic
1151688424 17:75664097-75664119 AAAGCACTTAGCACGAAGCCTGG + Intronic
1152805079 17:82351873-82351895 GAAGAACTGAGAACCATGGCTGG - Intergenic
1153194335 18:2577126-2577148 AAAGCACTTAAAACAATGTCTGG - Intronic
1153336232 18:3928556-3928578 GAAGCACTTGGAACCATGCCTGG - Intronic
1153342258 18:3987509-3987531 AAAGCACTTGGAACGATGCCTGG - Intronic
1153396641 18:4629149-4629171 AAAGCACCCAGAACAATGCCTGG + Intergenic
1153456852 18:5292430-5292452 AAAGCACATAGAACAATGCCTGG - Intronic
1153574613 18:6508068-6508090 AAAACACTTAGAATAATGCCTGG - Intergenic
1153900233 18:9612169-9612191 GAAGCACTTGGAACAATTCCTGG - Intronic
1154169727 18:12042601-12042623 AAAGCACTTAGCACAATTCCTGG - Intergenic
1155038686 18:22046761-22046783 GAAGCACTGAGAACAGTGCCTGG - Intergenic
1155316905 18:24580965-24580987 AAAGTATTTAGAACAATGCCTGG + Intergenic
1155495082 18:26434951-26434973 GAAGCACTTAGGATATTGCCTGG + Intergenic
1155509671 18:26563790-26563812 TAAGCACTTAAGAGTATGCCAGG - Intronic
1156104308 18:33639173-33639195 AAAGCACTTAGAACTGTGTCTGG - Intronic
1156233200 18:35174972-35174994 GAAACACTTAGAACAGTGCCTGG - Intergenic
1156316606 18:35974338-35974360 CCAGCACTTAGAACAGTGCCTGG + Intronic
1156470011 18:37371577-37371599 GAAGCCCTTTGAGCAATGCCAGG + Intronic
1156585844 18:38430039-38430061 GAAGCACATAGAAGTATTCAGGG - Intergenic
1156622011 18:38864095-38864117 GGAGCACTTTGAGCTATGGCTGG - Intergenic
1156650325 18:39218375-39218397 GAAACACTTACAACAATGCATGG + Intergenic
1157033865 18:43947151-43947173 GAAACACATAGAAGAATGCCTGG - Intergenic
1157057472 18:44247736-44247758 GACACACTTAGCACTGTGCCTGG + Intergenic
1157656466 18:49394322-49394344 AAAGCACTTAGAACAGTGCCTGG + Intronic
1157950900 18:52035774-52035796 TCAGCACTCAGAACAATGCCTGG - Intergenic
1158109925 18:53929550-53929572 GCACCACTTAGAACTGTGCAAGG - Intergenic
1158281416 18:55832543-55832565 AAAGTGCTTAGAACAATGCCTGG + Intergenic
1158724989 18:59962851-59962873 AAAACACTTATAACTGTGCCTGG - Intergenic
1158758546 18:60355988-60356010 GAAGTGCTTAGAATAATGCCTGG - Intergenic
1159095152 18:63893786-63893808 GAAGTTCTTAGAAAGATGCCTGG - Intronic
1159178606 18:64871596-64871618 AAAGTACTTAGTACAATGCCTGG - Intergenic
1159593490 18:70360219-70360241 AAAGTACTTAGAACAGTGCCTGG + Intergenic
1161549002 19:4900450-4900472 AAAGCGCTTAGAATAATGCCAGG - Intronic
1161786827 19:6331816-6331838 AAAGAACTAAGCACTATGCCTGG + Intronic
1163155202 19:15436508-15436530 AAAGTGCTTAGAACGATGCCTGG + Intronic
1164144509 19:22503713-22503735 GCAGAACTTAGCACTATGACTGG + Intronic
1164401273 19:27903988-27904010 CAGGCACTTACCACTATGCCTGG - Intergenic
1164701614 19:30288755-30288777 GATGCACTTAAAACACTGCCTGG + Intronic
1164811878 19:31163882-31163904 GAAGCACTTAGGAGGGTGCCTGG - Intergenic
1164829659 19:31310814-31310836 AAAGCACTTAGCACCATGCCTGG + Intronic
1164912167 19:32021835-32021857 GAAGCACTCAGCAAAATGCCAGG - Intergenic
1165217146 19:34283502-34283524 AAAGCACTTAGAATGATGTCTGG - Intronic
1165478870 19:36049689-36049711 AAAGCACTTAGAACAGTGCCTGG + Intronic
1166164093 19:40974656-40974678 AAAGCACTTAGAACAATGGCTGG + Intergenic
1166186748 19:41144680-41144702 AAAGCACTTAGAACAATGGCTGG - Intergenic
1166324345 19:42040026-42040048 GAAGAACTTAGAACAGGGCCTGG - Intronic
1166326688 19:42055116-42055138 AAAGCACTCAGAACAGTGCCTGG + Intronic
1167107414 19:47438333-47438355 GAAGTGCTTAGAACAGTGCCTGG + Intronic
1167194506 19:48018545-48018567 GAAGCACTTAAAATACTGCCTGG - Intronic
1167220102 19:48193772-48193794 CAAGCATTTAGAACATTGCCTGG - Intronic
1167329631 19:48847092-48847114 GTGGCACTTAGAACAGTGCCTGG + Intronic
1167444881 19:49531770-49531792 AAAGCACTTAGGACAATGCCTGG - Intronic
1167561684 19:50229841-50229863 GAAGCACCCTGAACAATGCCTGG - Intronic
1167632878 19:50636789-50636811 GAAGAACTTAGAACAATGCTGGG - Intronic
1167637442 19:50662989-50663011 AAAGCACTTAGAACAATGCCTGG - Intronic
1167677748 19:50898141-50898163 CAAGTGCTTAGAACAATGCCTGG - Intergenic
1167680934 19:50920465-50920487 AAGGCAGTTAGAACTCTGCCAGG + Intergenic
1168351248 19:55677326-55677348 AAAGCACTTAAAACAGTGCCTGG + Intronic
1168610798 19:57797999-57798021 CAAGCACCTACCACTATGCCCGG - Intronic
925374744 2:3376179-3376201 GAATCACGTAGAACAGTGCCTGG - Intronic
925503495 2:4533744-4533766 CAAGAACTTAGAACGGTGCCTGG - Intergenic
925613938 2:5727278-5727300 AAAGTACTTAGAACACTGCCTGG - Intergenic
925936491 2:8766585-8766607 CAAGCTCTCAGAACTGTGCCTGG + Intronic
926944432 2:18171403-18171425 GAAGCACTTGAAACAATGCCTGG + Intronic
927039621 2:19215127-19215149 AAAGCATTTAGCACTGTGCCAGG - Intergenic
927093569 2:19730386-19730408 AAAGCACTTAGAACAATGACTGG - Intergenic
927480272 2:23448301-23448323 TGAGCACTTAGAACAGTGCCTGG - Intronic
927507300 2:23622792-23622814 AAAGGACTTAGAACCATGCCTGG - Intronic
927526310 2:23744522-23744544 AAAGCACTTAGAACAGTACCAGG - Intergenic
927641528 2:24848648-24848670 CAAGCACTTAGAACAGTGCCTGG + Intronic
927712371 2:25333765-25333787 GAAACAGCTAGCACTATGCCTGG - Intronic
927728307 2:25446003-25446025 AAAGCACTTAGAATAATGACTGG + Intronic
927850276 2:26494518-26494540 GAAGCATTTAGGAGCATGCCTGG + Intronic
928123956 2:28603454-28603476 AAAGCACTTGAAACAATGCCTGG - Intronic
928453103 2:31396494-31396516 AAAGCTTTTAGAACAATGCCTGG - Intronic
928457981 2:31441042-31441064 GAAGCTCTTAGCACAATGCTTGG - Intergenic
928469205 2:31556916-31556938 AAAGTACTTAGAACATTGCCTGG - Intronic
928593306 2:32838572-32838594 AAAGCACTTAGCACAGTGCCTGG - Intergenic
928656447 2:33456879-33456901 AAAGCACTTAGCACAATGCCTGG - Intronic
928802972 2:35116174-35116196 AAAACACTTAGAATTATTCCTGG - Intergenic
928842408 2:35625935-35625957 CTAGCACTTAGGACAATGCCTGG + Intergenic
928875151 2:36029583-36029605 GAAGGACTTAGAACTATGAGAGG - Intergenic
929273391 2:39999183-39999205 AAAACACTGAGAACTATACCAGG - Intergenic
929870879 2:45758292-45758314 AAAGTATTTAGAACCATGCCTGG + Intronic
930164744 2:48194060-48194082 CAAGCATTTAGAACAATGCCTGG - Intergenic
930171071 2:48252329-48252351 TCAGCACCTAGAACTGTGCCTGG - Intergenic
930232556 2:48857833-48857855 GAAGCACCTAGAACAGTGCCAGG + Intergenic
930322187 2:49869605-49869627 GAAGGCCTTAGAACTCTGTCTGG + Intergenic
930434375 2:51321886-51321908 GAAGCACTTAGAACAGTCCCTGG - Intergenic
930670825 2:54148433-54148455 GAAGCACTTAGTGCAGTGCCTGG + Intronic
930766833 2:55093076-55093098 GCAGCTCTTAGAACAATGCAAGG - Intronic
931051455 2:58419597-58419619 GAAGCACTTTGAACAGTTCCTGG - Intergenic
931079796 2:58755767-58755789 GAAGTGGTTAGAACCATGCCTGG + Intergenic
931091302 2:58889553-58889575 GAAGGACTTAAAACAGTGCCTGG - Intergenic
931143248 2:59486941-59486963 GAAGTCCCTAGCACTATGCCTGG + Intergenic
931228684 2:60355728-60355750 AAAGCACTTAGAATTGTGTCTGG + Intergenic
931298392 2:60952617-60952639 AAAGCACTTAGAACAGTACCTGG - Intronic
931513559 2:63026427-63026449 AAAGCACTTAGAATAGTGCCAGG - Intronic
931691852 2:64840436-64840458 AAATCACTTAGCACAATGCCTGG + Intergenic
931740949 2:65243488-65243510 GAGGCACATATCACTATGCCTGG - Intronic
931773116 2:65516526-65516548 AAAGCACTTACAATAATGCCTGG - Intergenic
931844826 2:66192803-66192825 GAGCCACTTAGAACAATGGCTGG + Intergenic
932260194 2:70320555-70320577 AAAGCACCTAGAATAATGCCCGG - Intergenic
932382715 2:71300161-71300183 AGAGCACTTAGAGCAATGCCTGG + Intronic
932629413 2:73325657-73325679 AAAGTACTTAGAACAATGTCTGG - Intergenic
932670414 2:73733120-73733142 AAAGCACTTGGAACAATGCTAGG + Intronic
932785719 2:74601000-74601022 AAAGCACTTATAACAGTGCCTGG - Intronic
933168946 2:79104046-79104068 CAAGCATTTAGAATTGTGCCTGG - Intergenic
933765932 2:85709814-85709836 GAAGCATTTGGAACAGTGCCTGG - Intergenic
934030959 2:88046374-88046396 AAAGCACTTAGAAGAATGCATGG + Intronic
934059608 2:88281967-88281989 AGAGCACATAGAACTATGTCTGG + Intergenic
934178278 2:89596877-89596899 AAAGGACTTAGAACAATACCTGG - Intergenic
934288572 2:91671169-91671191 AAAGGACTTAGAACAATACCTGG - Intergenic
934741635 2:96728033-96728055 AAAGTGCTTAGAACAATGCCTGG + Intronic
935115733 2:100134803-100134825 CAAGGACCTAGAACAATGCCTGG - Intronic
935179411 2:100676568-100676590 GAAGCCCTTAGCACAGTGCCAGG - Intergenic
935340137 2:102052397-102052419 TAAGCACCTAGAACAATGCCAGG + Intergenic
935615362 2:105074522-105074544 GAAGCACTTAGAACTATGCCTGG - Intronic
935784819 2:106539159-106539181 GAAGCACTTAGCAGAGTGCCTGG + Intergenic
935918199 2:107981983-107982005 AGAGCACTTAGCACTGTGCCTGG - Intergenic
935959439 2:108410241-108410263 GAAGCACTTAGAAATGTGCTTGG + Intergenic
936100320 2:109572045-109572067 GAAGCATTTAGTACAATGCCTGG - Intronic
936661720 2:114550321-114550343 AAAGAACTTAGAACTGTGCCTGG - Intronic
936684736 2:114814812-114814834 GAAGGACTGAGAACCATGACAGG - Intronic
937019360 2:118636021-118636043 AAAGCACTTACAACAATGCGGGG + Intergenic
937159012 2:119742505-119742527 GAAGCACATACTACCATGCCTGG + Intergenic
937453192 2:122019254-122019276 AAAGCACTTAGAACAATCGCTGG + Intergenic
937615272 2:123914243-123914265 AAAGCACTTAGAATGGTGCCGGG + Intergenic
937727243 2:125181599-125181621 AAAGTAATTAGAACTATGACTGG + Intergenic
938671066 2:133587313-133587335 GAAGTGCTCAGAACAATGCCTGG + Intergenic
938733248 2:134162758-134162780 GAAGCACTTAGCATCATGTCTGG - Intronic
938736144 2:134188493-134188515 GAAGGTCTTAGAACCATGTCTGG + Intronic
938761803 2:134432821-134432843 TTAGCACTAAGAACAATGCCTGG + Intronic
938847437 2:135223936-135223958 AAAGCACTTAGCACAGTGCCTGG - Intronic
938986853 2:136584905-136584927 GAAGCACTTAGCACAATGACTGG + Intergenic
939536656 2:143439571-143439593 CAAGCACTTGGAACAGTGCCTGG - Intronic
939572065 2:143852268-143852290 GAAGCCTTTAGAACCGTGCCTGG + Intergenic
939724400 2:145698260-145698282 GAAGAATTTAAAACAATGCCGGG + Intergenic
939733946 2:145819948-145819970 AAAGCATTTAGCACAATGCCTGG - Intergenic
940539032 2:154986948-154986970 AAAGCACTTAGAACAATGCCTGG + Intergenic
940541973 2:155031724-155031746 GAAGCACATAGCACAGTGCCTGG + Intergenic
941087179 2:161131398-161131420 AACGTACTTAGAACTGTGCCAGG + Intergenic
941109567 2:161404046-161404068 CAAGCACTCACCACTATGCCTGG + Intronic
941204608 2:162556248-162556270 AAAGCACTTAGAACAGAGCCTGG - Intronic
941287635 2:163633321-163633343 AAAGCACTTAGAACATTTCCTGG - Intronic
941299087 2:163778457-163778479 GCAGCACTTGGAACAGTGCCTGG + Intergenic
941735537 2:168971242-168971264 GAAGTGCTTAGAACAGTGCCTGG + Intronic
941751704 2:169141457-169141479 CCAGCACTTAGAACAGTGCCTGG + Intronic
941846415 2:170138998-170139020 GAAGCACTTAGAATAGTACCTGG - Intergenic
942124163 2:172806492-172806514 AAAGCACTTAGTACAAAGCCTGG + Intronic
942205464 2:173615875-173615897 AAAGCACTTAGCTCTGTGCCTGG - Intergenic
942329991 2:174813072-174813094 AAAGCACTTAGAATAGTGCCTGG - Intronic
942397997 2:175572530-175572552 GAAGCACTTAGCACAATTCCAGG + Intergenic
942500638 2:176586947-176586969 AAAGCACTTAGAATAATTCCTGG - Intergenic
942523719 2:176830882-176830904 AAAGCACTTAGAACAGTACCTGG - Intergenic
942552355 2:177132414-177132436 GAAGCACTTAGAATGGTGCTTGG - Intergenic
942973322 2:181983401-181983423 AAAGCACTTAGAATAATTCCTGG + Intronic
943362176 2:186932718-186932740 CAAGCACATAGAAATATGACTGG - Intergenic
943553384 2:189370009-189370031 AAAGCACATAGAACAATGCCTGG - Intergenic
944108795 2:196108676-196108698 CAAGCACTTAGAACAATGCTTGG + Intergenic
944427290 2:199596483-199596505 GAAGGACTTAGAAATATGCATGG + Intergenic
944540961 2:200753148-200753170 AAAGCACTTAGAACAGTACCTGG + Intergenic
944595346 2:201256084-201256106 GGAGCACTTAGAATAGTGCCTGG - Intronic
944712590 2:202348377-202348399 GAAGTACTTAGAACAATACCTGG + Intergenic
944868997 2:203891303-203891325 GAAGCACCTAGAGCAATGCATGG - Intergenic
944906936 2:204271131-204271153 AAAGCACTTAGAACAGTGGCTGG - Intergenic
945373411 2:209049746-209049768 TTAGGGCTTAGAACTATGCCTGG + Intergenic
945709839 2:213282126-213282148 AAAGCACTTATAACCATGTCTGG - Intergenic
945892221 2:215442214-215442236 AGAGCACTTAGCACTGTGCCTGG - Intergenic
946035568 2:216739644-216739666 GAAGCACTTAGGACAGTGCCTGG - Intergenic
946412968 2:219524505-219524527 AAAGTGCTTAGAACTGTGCCTGG + Intronic
946793477 2:223324732-223324754 GAAGTACTTAGGATTGTGCCTGG + Intergenic
946883524 2:224200359-224200381 AAAGCACTTAGAGAAATGCCTGG + Intergenic
947116672 2:226779030-226779052 CAAGAACTTAGGAGTATGCCTGG + Intronic
947186693 2:227461737-227461759 AAAGCACTTAAAACAATGTCTGG - Intergenic
947192525 2:227522504-227522526 AAAGCACTGAGAACAATTCCTGG - Intronic
947369457 2:229429475-229429497 GAAGCATTAAGCACAATGCCTGG + Intronic
947813142 2:233017222-233017244 AAAGCACTTAGAACAGTGCCTGG - Intergenic
948313535 2:237009027-237009049 TAAGCACTCAGAACAGTGCCTGG + Intergenic
1168754733 20:308449-308471 TGAGCAATTAGCACTATGCCTGG + Intergenic
1168770382 20:410701-410723 GAAACACTTTGCACAATGCCTGG + Intronic
1168804876 20:666473-666495 GAAGCACTTAGCACAGAGCCTGG - Intronic
1168876428 20:1175217-1175239 AAAGCACTTAGCACGGTGCCTGG - Intronic
1168883820 20:1229358-1229380 AAAGCTCTTAGGACAATGCCTGG + Intronic
1168908045 20:1422645-1422667 TATGCACTTAGCACTGTGCCGGG + Intergenic
1169026591 20:2376680-2376702 AAAGCACTTAGAACACTGCCTGG - Intergenic
1169240026 20:3969149-3969171 AAAGCACTTAGAACAGTACCTGG + Intronic
1169340257 20:4790961-4790983 AAAGCACTTAGAATAGTGCCTGG + Intronic
1169391503 20:5194885-5194907 TAAACCCTTAGCACTATGCCTGG - Exonic
1169391536 20:5195157-5195179 TAAGCATTTAGTACCATGCCTGG + Exonic
1169427140 20:5505015-5505037 CAAGCACACACAACTATGCCTGG - Intergenic
1169457686 20:5766659-5766681 GAAGCTCTTAGCACAATGCCTGG + Intronic
1169688561 20:8304735-8304757 GGAGCACTTAGAACACTGCCTGG - Intronic
1169877096 20:10309938-10309960 GAAGCACTTAGCACAATGCCTGG - Intergenic
1170208810 20:13827601-13827623 TAAGCACTTAGGACAGTGCCTGG - Intergenic
1170302718 20:14903616-14903638 GGAGCACTTAGAATTTTGACAGG + Intronic
1170490244 20:16865085-16865107 AAAGGGCTTAGAACAATGCCTGG + Intergenic
1170829995 20:19832017-19832039 GAAGCCCTTGGAACACTGCCAGG - Intergenic
1170838080 20:19902061-19902083 AAAGTGCTTAGAACAATGCCTGG - Intronic
1170920683 20:20676782-20676804 CAAGCACTTAGCACGATGCTTGG - Intronic
1170971246 20:21118564-21118586 GATGCACTTGGAATCATGCCTGG - Intergenic
1171988326 20:31676238-31676260 GAAGCACTTAGCACCATGCCTGG - Intronic
1171990786 20:31694654-31694676 GAAGGGCTTAGGACAATGCCTGG - Intronic
1171993164 20:31712423-31712445 AAAGCACTTTGAACAATGGCTGG + Intronic
1172029708 20:31973335-31973357 CCAGCACTTAGAACAGTGCCTGG - Intronic
1172120585 20:32596440-32596462 AAAGCACTTAGCACAGTGCCCGG + Intronic
1172193457 20:33076327-33076349 AAAGCACTTAGAACAGTGTCTGG - Intergenic
1172392774 20:34577173-34577195 AAAGAACTTAGCACTGTGCCTGG + Intronic
1172591336 20:36120158-36120180 GAATCACTTATAACCACGCCTGG - Intronic
1172597275 20:36157987-36158009 GAAGCCCTTAAAACTGGGCCTGG - Intronic
1172714512 20:36952653-36952675 AAAGCCCTTAGAACCGTGCCTGG - Intergenic
1172810194 20:37641880-37641902 AAAGTGCTTAGAACAATGCCCGG + Intergenic
1172840428 20:37899942-37899964 AAAGCACTTAGAACAATGCCAGG - Intergenic
1173075860 20:39818628-39818650 GAAGTGCTTAGAATTATGCTGGG + Intergenic
1173336747 20:42118314-42118336 GAGGCACTTAGCACGATGCATGG + Intronic
1173458970 20:43226561-43226583 GAAGCCCTTGGAACAAAGCCTGG - Intergenic
1173585337 20:44177897-44177919 GAAGCACTGAGCATCATGCCTGG - Intronic
1173593879 20:44246778-44246800 AAAGCTCTTAGAACAGTGCCTGG + Intergenic
1173692032 20:44967879-44967901 AAAGCACTTAGAACAGTGCCTGG - Intronic
1173847035 20:46194672-46194694 AAAGCACTCAGCACAATGCCTGG + Intronic
1173899129 20:46574181-46574203 GAAGCACTTCAAACAATGGCTGG + Intronic
1173899475 20:46576644-46576666 GACACACTTAGACCCATGCCTGG + Intronic
1173944513 20:46940256-46940278 AAAGCACTTACAGCTATGCCTGG - Intronic
1174109827 20:48191211-48191233 AATGCACTTGGAACTGTGCCTGG - Intergenic
1174109872 20:48191580-48191602 AAAGCACTTAGCACAATGCCAGG - Intergenic
1174203672 20:48824573-48824595 AAAGCACTTAGAACAGTGTCTGG - Intronic
1174280828 20:49437958-49437980 AAAGCACTTAGAACAGTGCCTGG + Intronic
1174323065 20:49757592-49757614 GAGGCACTTGGAACATTGCCGGG - Intergenic
1174423673 20:50416979-50417001 GAAGCGCTCAGAAGCATGCCTGG - Intergenic
1174752494 20:53125450-53125472 GAAGCTTTTAGAACATTGCCTGG + Intronic
1174805978 20:53604815-53604837 CCAGCACCTAGAACAATGCCTGG - Intronic
1174836749 20:53863099-53863121 AAACCACTAAGAACAATGCCTGG + Intergenic
1174940456 20:54920767-54920789 GCATCACATAGAACTGTGCCGGG - Intergenic
1175043504 20:56079005-56079027 GAAGCATTTAGAACAATGCCTGG + Intergenic
1175080800 20:56418836-56418858 GAAGCATTTAGAACAGTGCCTGG - Intronic
1175166930 20:57050616-57050638 TAAGCACTTAGTACAAAGCCTGG + Intergenic
1175228277 20:57457952-57457974 GGAGCACTTAGAACAATGCCTGG - Intergenic
1175315859 20:58046170-58046192 AAAGCACTCAGAACAGTGCCTGG - Intergenic
1175332814 20:58176664-58176686 AAAGCACTTAGAGCAATGCCTGG - Intergenic
1175357184 20:58377623-58377645 GCAGCTCTTAGAACAGTGCCTGG + Intergenic
1176340888 21:5694785-5694807 GAAAAACTTAGAAACATGCCAGG - Intergenic
1176473142 21:7126938-7126960 GAAAAACTTAGAAACATGCCAGG - Intergenic
1176503939 21:7629671-7629693 GAAAAACTTAGAAACATGCCAGG + Intergenic
1176732830 21:10517903-10517925 CCAGCACCTAGAACAATGCCTGG + Intergenic
1176964883 21:15201408-15201430 AAAGTACTTAGAACAGTGCCTGG + Intergenic
1177017068 21:15804708-15804730 CAAGCACTTAGAACAGTGCCTGG + Intronic
1177110912 21:17027223-17027245 GAAGCACTTGGAACCAGGCTTGG + Intergenic
1177222275 21:18209842-18209864 GGAGGACTTAGGACTCTGCCTGG + Intronic
1177581462 21:23028185-23028207 AAAGCCCTTAGAACAGTGCCTGG + Intergenic
1178048400 21:28721685-28721707 AAAGTACTTAGAACAGTGCCTGG - Intergenic
1178107059 21:29331799-29331821 GAAGAACTTAGAACAATGCCTGG + Intronic
1178347125 21:31839745-31839767 AAAGCCCTTAGAACAGTGCCTGG + Intergenic
1178356757 21:31916020-31916042 AAAGCACTTAGTACAATGTCTGG - Intronic
1178457087 21:32765422-32765444 GAAGCACTTCGATTTTTGCCTGG - Intronic
1178469759 21:32881949-32881971 GAAGCACTTTGCACTGTGTCTGG + Intergenic
1178499097 21:33110923-33110945 AAAGGACTTAGAACCCTGCCTGG - Intergenic
1178681162 21:34672885-34672907 AAAGCACTTAGAAAAGTGCCTGG + Intronic
1178722357 21:35021293-35021315 AAAGCACCTAGAACAATTCCTGG + Intronic
1178727398 21:35066057-35066079 GAAGCACTTAGAAAAATTCTTGG + Intronic
1179150034 21:38802124-38802146 CAAGCACTTAGAACAGTGTCTGG - Intergenic
1179166684 21:38940800-38940822 GAAGCACTTAGAATAGTGCCTGG - Intergenic
1180620357 22:17157975-17157997 GAAGTACTTAGAATAGTGCCTGG + Intronic
1180845401 22:18978545-18978567 GAAGCACTTAGAACGGTGCCTGG + Intergenic
1181139474 22:20793954-20793976 GAAGCACTGAGCACAGTGCCTGG - Intronic
1181658963 22:24326675-24326697 TAAGCACTTAGAAAAAAGCCTGG + Intronic
1181813072 22:25416359-25416381 AAAGCGCTTAGAACTGTGTCTGG - Intergenic
1181831051 22:25560551-25560573 AAAGCACTTAGAACTGTGTCTGG - Intergenic
1181892870 22:26079596-26079618 GAAGCCATTAGAACTTTGGCAGG - Intergenic
1181978193 22:26747415-26747437 CAAGGCCTTAGAACAATGCCTGG - Intergenic
1182070628 22:27461303-27461325 AAGGCACTTAGAACAATGACTGG - Intergenic
1182196470 22:28523872-28523894 GAAGCTCTTAGTACTGTGCTTGG - Intronic
1182207495 22:28643841-28643863 AAAGTACTTAGAACTGTGCCAGG - Intronic
1182450492 22:30417611-30417633 GAGGCACTTAGCATAATGCCTGG + Intronic
1182694333 22:32186349-32186371 AAAGCACTTAGTACAGTGCCCGG - Intergenic
1182830849 22:33303462-33303484 CAAGCACTCAGAACAGTGCCTGG + Intronic
1182842833 22:33405746-33405768 GAAGCACTTAGCACAGGGCCTGG + Intronic
1183009535 22:34933356-34933378 GGAGCACTTAGAACAGTGCCTGG - Intergenic
1183009862 22:34936045-34936067 CCAGCACCTAGAACAATGCCTGG - Intergenic
1183055235 22:35300855-35300877 GAAATACTTAGAACAATGCCTGG + Intronic
1183257931 22:36775063-36775085 CAAGCACCCAGAACAATGCCTGG - Intronic
1183366771 22:37411056-37411078 GAAGCACTTGGTGCTACGCCTGG - Intronic
1183516585 22:38270398-38270420 AAAGCGCTTTGAACTGTGCCTGG + Intronic
1183776143 22:39967405-39967427 AAAGCGCTTAGAACAGTGCCTGG + Intronic
1183944840 22:41319425-41319447 TAAGCACTTGCCACTATGCCCGG - Intronic
1184830220 22:46981269-46981291 GAAGCACTCAGGACCATGTCAGG - Intronic
1203240155 22_KI270733v1_random:9243-9265 GAAAAACTTAGAAACATGCCAGG - Intergenic
949164982 3:929143-929165 GAAGCACCTAGGATAATGCCTGG + Intergenic
949253600 3:2018653-2018675 AAAGCACTTAGTACTGTGCCTGG - Intergenic
949348179 3:3096871-3096893 AAAGCACTTAGAACAGTGCCTGG - Intronic
949364573 3:3267086-3267108 AAAGCACTCAGAACAGTGCCTGG - Intergenic
949385736 3:3500477-3500499 GAAGCACTCAGAAAAATGCCTGG - Intergenic
949388641 3:3534978-3535000 GAAGAACATAGAACGGTGCCTGG - Intergenic
949657750 3:6240455-6240477 AAAGCACTTAACACTGTGCCTGG + Intergenic
949659680 3:6263882-6263904 AAAGCACTTAGCACAATGTCTGG - Intergenic
949691702 3:6647981-6648003 TCAGCACTTAGAACTATGCCTGG - Intergenic
949807071 3:7967082-7967104 AAAGCATTTAGAACAATGCCTGG + Intergenic
949865389 3:8542874-8542896 GAAGCACTTGGAAGAGTGCCTGG + Intronic
949905557 3:8855667-8855689 AATACACTTAGCACTATGCCTGG + Intronic
950079153 3:10208891-10208913 GAAGTATTTAGAACAGTGCCTGG + Intronic
950196586 3:11013615-11013637 AAAGCATGTACAACTATGCCTGG - Intronic
950356868 3:12418590-12418612 GAAGTGCTTAGAACACTGCCTGG - Intronic
950368578 3:12507623-12507645 GTAGCACTTAGCCCAATGCCTGG - Intronic
950500599 3:13361219-13361241 GTGGCACCTAGAACCATGCCTGG + Intronic
950560136 3:13716475-13716497 GAAGTACTTAGAAGCGTGCCTGG - Intergenic
950577503 3:13841567-13841589 GAAGTAATTAGAACAGTGCCTGG + Intronic
950849360 3:16048157-16048179 GAAGAACTTAGGACAATGCCTGG - Intergenic
950873449 3:16249156-16249178 AAAGCACTTAGAACAAGGCCTGG - Intergenic
951041187 3:17990326-17990348 AAAGCACTTGGAACAGTGCCTGG + Intronic
951051168 3:18095801-18095823 GGAGCACTTAGTACAGTGCCTGG + Intronic
951466674 3:23007776-23007798 AAAGCACTTGGAACTCTGCCTGG + Intergenic
951547055 3:23837150-23837172 AAAGCACTTGGAACAGTGCCTGG + Intronic
951581509 3:24169614-24169636 AAAGCACTTAGAATGATGACTGG + Intronic
951680869 3:25293377-25293399 GAACCACTTAGACCAGTGCCTGG + Intronic
951730222 3:25802283-25802305 GAGGCACTTGAAACAATGCCTGG - Intergenic
951892028 3:27576387-27576409 GAAGCAGCTAGAACAATGACTGG - Intergenic
951908677 3:27728229-27728251 GAAGCAATTAGAACAGTACCTGG + Intergenic
951968149 3:28412667-28412689 AAAGCACTTAGAATAATACCTGG + Intronic
952006334 3:28846410-28846432 GGTGCACTTAGAACAGTGCCTGG - Intergenic
952054144 3:29424028-29424050 AAAGCTCTTAGAATTGTGCCTGG + Intronic
952109330 3:30104358-30104380 TAAGCACCTAGAAGTATCCCTGG + Intergenic
953100129 3:39816526-39816548 GAAGCACTCTGAACAGTGCCTGG + Intronic
953274880 3:41485057-41485079 AAAGCACTTAGAATAATACCTGG - Intronic
953313412 3:41902890-41902912 AAAGCACTTAAAACAATGCCTGG + Intronic
953388330 3:42519853-42519875 GAAGCACTTACCAGTGTGCCAGG + Intronic
953435835 3:42876441-42876463 AAAGCACTTAGAATAGTGCCTGG + Intronic
953638603 3:44684982-44685004 CAAGCATTTAGAACAGTGCCTGG + Intergenic
953669841 3:44953044-44953066 AAAGCATTTGGAACTATGCCTGG - Intronic
953742841 3:45552037-45552059 AAAGCACTTAGAACAGGGCCTGG - Intergenic
954512159 3:51134970-51134992 GAAATACTTAAAACAATGCCTGG + Intronic
954528507 3:51295981-51296003 CAGGCACTGACAACTATGCCTGG + Intronic
954729642 3:52648750-52648772 GAAGCACTTAGAACTGTGCTTGG - Intronic
954913680 3:54131028-54131050 AAAGCACTTAGCACTGTGCCTGG + Intronic
955307906 3:57852554-57852576 AAAGCACTTAGAACAGTTCCTGG + Intronic
955399144 3:58578944-58578966 CCAGCACTTAGAACAGTGCCAGG - Intronic
955438324 3:58928407-58928429 AAAGCTCTTAGAACAGTGCCTGG - Intronic
955551500 3:60090004-60090026 AAAGCATTTAGATCAATGCCTGG - Intronic
955727468 3:61948420-61948442 CCAGCACCTAGAACAATGCCTGG - Intronic
955754554 3:62214697-62214719 TAAGCACCTAGAAGTGTGCCTGG - Intronic
955856095 3:63275747-63275769 AAAGCACTTAGCACAATGCCTGG + Intronic
955878428 3:63518685-63518707 AAAGCACTCAGAACTGTGCCAGG - Intronic
955901325 3:63758980-63759002 AAAGCACTTAGAATAGTGCCTGG + Intergenic
956058703 3:65328075-65328097 CAAGCACTGAGAACAGTGCCAGG + Intergenic
956173644 3:66453322-66453344 AAAGCTCTTAGAGCTGTGCCTGG - Intronic
956251152 3:67235670-67235692 TAAGCACTTAGAACAAAGCCTGG + Intergenic
956351747 3:68344756-68344778 AAAGCACTTAGCACAATGCCTGG - Intronic
956501684 3:69893504-69893526 AAAGCACTTAGCACGGTGCCAGG + Intronic
956725537 3:72153557-72153579 AAAGCACTTAGCATTGTGCCTGG - Intergenic
956802221 3:72770021-72770043 AAAGCACTTAGCACAATGCCTGG + Intronic
956877399 3:73477179-73477201 AAAGCATTTAGAACAGTGCCTGG + Intronic
956959134 3:74376867-74376889 AAAGCACTTAGCACTATACCTGG - Intronic
957072537 3:75578347-75578369 GAAGCACTTAGCATTGTGCCTGG - Intergenic
957154093 3:76524757-76524779 GTAGCACTTTGAAATATGCCAGG + Intronic
957367019 3:79238638-79238660 CAAGCACTTAAAACTATGTCAGG - Intronic
957496232 3:80994482-80994504 GAAGCACTTAACAATAAGCCAGG + Intergenic
957885085 3:86276926-86276948 AAAGTACATAGAACAATGCCTGG - Intergenic
957968478 3:87352572-87352594 AAAGCACTTACAACTGTGCTTGG + Intergenic
958547263 3:95570013-95570035 GAAGCATTTAGAACAATCCCAGG + Intergenic
958905529 3:99937847-99937869 GAAGCACTTAAAACAGTGCCTGG - Intronic
959348228 3:105226841-105226863 GAAGCACTTAGACCAGTGCCAGG + Intergenic
959887333 3:111517733-111517755 GAACCACTTAACACAATGCCTGG - Intronic
959911385 3:111767638-111767660 GAAGTACTTAAAACTGTACCTGG + Intronic
960025961 3:113009785-113009807 AAAGCACTTAGAACAATGCCTGG + Intronic
960041563 3:113155090-113155112 GAAGCACTTAAAATAATGGCAGG + Intergenic
960115846 3:113891358-113891380 CAAGCACCTAGCACTGTGCCTGG - Intronic
960315049 3:116166259-116166281 AAAGCACTTAGAACTGTGCCTGG - Intronic
960829705 3:121833899-121833921 AAAGCAATTAGAACAATTCCTGG - Intronic
960848291 3:122024616-122024638 GAAGCACTAAGAACATTGCTTGG - Intergenic
961021918 3:123515075-123515097 AAAGCACTTAGAACACTGCCTGG - Intronic
961077139 3:123992513-123992535 AATGCACTTAGAACAATTCCTGG - Intergenic
961182704 3:124888567-124888589 AAAGGACTTAGAACAGTGCCTGG - Intronic
961281540 3:125768405-125768427 GAAGCACTTAGCCTTGTGCCTGG + Intergenic
961307436 3:125968787-125968809 AATGCACTTAGAACAATTCCTGG + Intergenic
961388257 3:126536585-126536607 GCAACACAAAGAACTATGCCTGG - Intronic
961575522 3:127832903-127832925 CAAGTACTTAGCACAATGCCTGG + Intergenic
961737654 3:129012276-129012298 AAAGCATTTAGAATGATGCCTGG + Intronic
961872829 3:130001175-130001197 GAAGCACTTAGCGTTGTGCCTGG - Intergenic
962007106 3:131360628-131360650 AAAGCACTTAGAACAGTGCAAGG - Intergenic
962009470 3:131380344-131380366 TAGGCACTTAGAACAGTGCCAGG - Intergenic
962024458 3:131532570-131532592 CAAGCACTTAGAACAGTGCCTGG + Intergenic
962231600 3:133670276-133670298 GAAGCACTTAGTACAATGCCTGG + Intergenic
962284398 3:134074349-134074371 GAAGTGCTTAGAACAGTGCCAGG + Intronic
962626387 3:137229678-137229700 GAAGTTCTTAAAACCATGCCTGG + Intergenic
962777021 3:138671240-138671262 GAAGAACTTAATACAATGCCTGG + Intronic
962832865 3:139159456-139159478 AAAGTATTTAGAACTGTGCCTGG - Intronic
962905231 3:139795302-139795324 AAAACACTTAGAACTGTGCCAGG - Intergenic
962958578 3:140289124-140289146 AAAGCCCTTGGAACCATGCCTGG - Intronic
963322093 3:143820064-143820086 GAAGCACTTAGAATAGTGTCTGG - Intronic
963670869 3:148250570-148250592 GAAACACTTAGGACAATGCCTGG - Intergenic
963774753 3:149427204-149427226 CCAGCACTTAGAACAGTGCCTGG + Intergenic
963776769 3:149447867-149447889 CAAACACTTAGAACAATGACTGG + Intergenic
963937885 3:151073309-151073331 AAAGAACTTAGAACAATGCTTGG - Intergenic
964052822 3:152417615-152417637 GAAGCATCTAGTATTATGCCTGG + Intronic
964084595 3:152800635-152800657 GAAGCCCTTGATACTATGCCAGG - Intergenic
964246974 3:154665449-154665471 CTAGCACTTAGCACTATGCCTGG - Intergenic
964351537 3:155807902-155807924 GAAGCACCTAGAACAATACCTGG - Intergenic
964526909 3:157624809-157624831 GAAGCATTTAGCACAGTGCCTGG - Intronic
964623888 3:158740559-158740581 GAAGCATTTAGGACAATGCCTGG + Intronic
964656880 3:159076958-159076980 AAAGTACTTAGAACAGTGCCTGG + Intronic
964659813 3:159107643-159107665 AAAGCACTTAGAGCAATGCCTGG - Intronic
965419157 3:168435794-168435816 TAAGCACTTAGAACAGTGCCTGG - Intergenic
965806731 3:172549881-172549903 AAAGCACTTAGCACAGTGCCAGG - Intergenic
965834885 3:172840391-172840413 GAAGTGTTTAGAACTGTGCCTGG - Intergenic
966005384 3:175005130-175005152 AAATTACTTAGAACAATGCCGGG - Intronic
966310115 3:178584518-178584540 AAAGCACCTAGAACAGTGCCTGG + Intronic
966339948 3:178914610-178914632 AAAGTGCTTAGAACTATGCCTGG - Intergenic
966984919 3:185171431-185171453 AAAGCACTTAGCATAATGCCAGG + Intergenic
967038989 3:185672032-185672054 TAAACACTTAGCACAATGCCTGG - Intronic
967157106 3:186703397-186703419 AAAGCACTTATAAGAATGCCTGG - Intergenic
967199512 3:187059695-187059717 AAAGCACTTAGAACAATACCTGG + Intronic
967356055 3:188573101-188573123 AAAGCACTTACAACAGTGCCTGG - Intronic
967544488 3:190708387-190708409 AAAGTACTTAGAATCATGCCTGG - Intergenic
967761594 3:193232069-193232091 TAAATACTTAGAACAATGCCTGG - Intergenic
967999517 3:195195246-195195268 AAAGCACTTAGAACAATGCCTGG + Intronic
968181065 3:196595633-196595655 GAGCCACTTAGAACAGTGCCAGG + Intergenic
969016140 4:4105682-4105704 GAAGCACTTAGCGTTGTGCCTGG - Intergenic
969140805 4:5069981-5070003 GCAGCACTTAGGAGGATGCCTGG + Intronic
969146617 4:5129922-5129944 CAAGCACCTAGAACAGTGCCTGG - Intronic
969737813 4:9002666-9002688 GAAGCACTTAGCGTTGTGCCTGG + Intergenic
969830971 4:9796521-9796543 AAAGGACTTAGAACAATACCTGG + Intronic
969841149 4:9883219-9883241 AAAGCACTTAGAACAGGGCCTGG + Intronic
969848865 4:9941428-9941450 GAAGCACTCAGACCAGTGCCTGG + Intronic
969916728 4:10498705-10498727 AAAACACTTAGAACAGTGCCTGG - Intronic
970319229 4:14859431-14859453 AAAGCACTTAGAATAATGGCTGG + Intergenic
970320396 4:14869748-14869770 CAAGCACTTAGCACATTGCCTGG + Intergenic
970492352 4:16587263-16587285 AAAGCACTTAGAACAATGCCTGG - Intronic
970550571 4:17176955-17176977 AAAGCACTTAGAACAATGGCCGG + Intergenic
970823509 4:20247995-20248017 TAAGCACCTAGCTCTATGCCAGG + Intergenic
971152413 4:24047440-24047462 AAAGCACTTAGCACAGTGCCAGG - Intergenic
971215312 4:24657143-24657165 GAAGCACCTTGAATTATGCCTGG - Intergenic
971297600 4:25411738-25411760 TAAGCACTTAGACTAATGCCTGG + Intronic
971306236 4:25484163-25484185 GCAGCTCTCAGAACCATGCCTGG + Intergenic
971377231 4:26064801-26064823 AAAGCATTTAGAACAGTGCCTGG + Intergenic
971768696 4:30868212-30868234 AAAACACTTAGCACCATGCCTGG - Intronic
971866406 4:32177681-32177703 GAAGCACTTAGAACACTGTTTGG - Intergenic
972462611 4:39319154-39319176 AAAGCACTTAGAGCAGTGCCTGG - Intronic
972590326 4:40479892-40479914 GAAACACTTAGAACAGTGCCTGG - Intronic
972681281 4:41309255-41309277 TCAGCATTTAGAACTATGCTAGG - Intergenic
972686522 4:41358888-41358910 AATGCACTTAGAACAGTGCCTGG + Intergenic
972708268 4:41567321-41567343 AAAGCCCTCAGAACAATGCCTGG + Intronic
972715845 4:41644999-41645021 AAAGTACTTAGAACAATGCCTGG - Intronic
972999275 4:44925680-44925702 CAAGCACCTAGAACTGTCCCAGG - Intergenic
973271969 4:48270449-48270471 GAAGTACCTAGAACAGTGCCTGG - Intergenic
973570107 4:52230008-52230030 AAAGCACCTAGAACAATACCTGG + Intergenic
973634660 4:52850953-52850975 GGAGCACTCAGAACAGTGCCTGG + Intergenic
973801832 4:54485961-54485983 TAAGCACATAGCACAATGCCTGG - Intergenic
973809552 4:54556865-54556887 AAAGCACTGAGAACAGTGCCTGG - Intergenic
973843897 4:54891278-54891300 AAAGCACTTAGAACAGTGCCTGG + Intergenic
973861573 4:55070124-55070146 AAAGCACTTAGGACAGTGCCTGG - Intergenic
973922844 4:55706204-55706226 AAAGCACTAAGAACATTGCCTGG - Intergenic
974420243 4:61663375-61663397 GAAGCTGTTTGTACTATGCCTGG + Intronic
974578342 4:63759956-63759978 AAATAACTTAGAACAATGCCTGG + Intergenic
974869410 4:67621408-67621430 CAAGCACTTAGATCAATACCTGG - Intronic
974927357 4:68316710-68316732 AAAGTGCTTAGAACAATGCCTGG - Intronic
975387561 4:73774961-73774983 AGAACACTTAGAACAATGCCTGG - Intergenic
975491612 4:74995415-74995437 TAAACACTTAGAACAGTGCCAGG - Intronic
975493507 4:75013587-75013609 AAAGCACTTAGAACAGTTCCTGG + Intronic
975771394 4:77727186-77727208 AAAGCACTTAGAACAGTGCCTGG - Intronic
975820338 4:78264725-78264747 GAAGCACTTAGAACAGTGCCTGG + Intronic
975824856 4:78308728-78308750 AAAGCACTTGGAACCGTGCCTGG - Intronic
976066453 4:81193433-81193455 AAAGCACTAAGAACTGTGCCTGG + Intronic
976338278 4:83916195-83916217 GAGGCACCTAGAACAATGTCTGG + Intergenic
976480831 4:85542951-85542973 TAAGCACTTACAACATTGCCTGG + Intronic
976546356 4:86340113-86340135 AAAGTTATTAGAACTATGCCTGG - Intronic
976593532 4:86872945-86872967 AAAGCAGTTAGAACAGTGCCTGG - Intergenic
976618672 4:87105122-87105144 AAAGCACTCAGAACAGTGCCAGG - Intronic
976625054 4:87171335-87171357 AAAGCACTAAGAACAATGTCTGG + Intronic
976671312 4:87657530-87657552 AAAACACTCAGAACTGTGCCTGG - Intronic
976890247 4:90038348-90038370 AAAACACTTGGAACAATGCCTGG - Intergenic
976895219 4:90101294-90101316 AAAGCACATAGAATAATGCCTGG + Intergenic
977093199 4:92705378-92705400 TAAGCACTTTCAACAATGCCTGG - Intronic
977125162 4:93156157-93156179 GAAGTACTTGGAACAGTGCCTGG + Intronic
977186416 4:93943461-93943483 AAAGCCCTTAGAAATATGACTGG - Intergenic
977196478 4:94067210-94067232 AAAACACTTAAAACTAGGCCGGG - Intergenic
977327995 4:95601694-95601716 AAAGTTCTTAGAACGATGCCTGG - Intergenic
977604492 4:98968701-98968723 ACAGCACTTAGAACAATGTCTGG - Intergenic
977641377 4:99361306-99361328 AAGGCACTTAGAACACTGCCTGG - Intergenic
977641485 4:99362395-99362417 AAAGCACTTAGAACAGTGCCTGG + Intergenic
977705473 4:100065822-100065844 AAAGCACTTAGAACAGTGCCTGG - Intergenic
977920151 4:102634458-102634480 GAAGCACCTAGAACACAGCCTGG + Intronic
977921756 4:102652527-102652549 AAAGTAATTAGAACTTTGCCTGG - Intronic
977923368 4:102670347-102670369 AGAGCACTTAGAACAATGCCTGG + Intronic
978171646 4:105678586-105678608 AAAGCACTTAGAACAATGTCTGG - Exonic
978202069 4:106033693-106033715 AAAGCACTTAGCAGAATGCCTGG - Intergenic
978264879 4:106811334-106811356 AAAGGACTTAGAACTGTGGCTGG + Intergenic
978267811 4:106847821-106847843 AAAGCACTTAAAACAGTGCCTGG + Intergenic
978282429 4:107034982-107035004 AAAACGCTTAGAACTGTGCCTGG + Intronic
978335462 4:107663489-107663511 GAAGCTCTTAGAACAATGAGTGG - Intronic
978528630 4:109692323-109692345 AAACCACTTAGAACAGTGCCTGG - Intronic
978749994 4:112235544-112235566 AAAGTACTTAGAACAGTGCCTGG - Intronic
979176689 4:117673653-117673675 AAAGCACTTATAATTATGCCTGG - Intergenic
979386918 4:120077718-120077740 AAAGCACATAGAAATGTGCCTGG - Intergenic
979392723 4:120145443-120145465 AAAGCACTTAAAACAGTGCCGGG + Intergenic
979466821 4:121048900-121048922 AAAGAACTTAGAAGAATGCCTGG - Intronic
979555831 4:122046391-122046413 AAAGCTCTTAGAACAATGTCTGG + Intergenic
979772369 4:124543596-124543618 GAATCACTTAAAACAATACCTGG - Intergenic
980000333 4:127479827-127479849 AAAGCACTTAGAAATATGTATGG - Intergenic
980019200 4:127688751-127688773 GAAGTATTTAGAATTGTGCCCGG + Intronic
980138966 4:128893479-128893501 AAAGCACCTAGAACAGTGCCTGG - Intronic
980678376 4:136121456-136121478 GAGGTACTTAGAACTGTGCCTGG - Intergenic
980877912 4:138680422-138680444 CAAGCTCCTAGAACTGTGCCTGG - Intergenic
980946546 4:139326370-139326392 AAAGCACTTAGCACAGTGCCTGG + Intronic
980955459 4:139423977-139423999 AAAGCACTTAGAACCAAACCTGG - Intergenic
981008549 4:139900854-139900876 AAAGCACTTAGCTCAATGCCTGG - Intronic
981027360 4:140090454-140090476 TAAGCACTTAGAACAGTGCCTGG - Intronic
981073215 4:140567063-140567085 GAAGCACTTAGAACAATGTCTGG + Intronic
981217364 4:142186233-142186255 TAAGCATTTATAACTGTGCCTGG - Intronic
981398349 4:144281306-144281328 GCAGCACTTAGAATGATGGCTGG + Intergenic
981633736 4:146851177-146851199 AAAGCACTTAGACCTATGTCTGG - Intronic
982062588 4:151619715-151619737 CAAACACTTAGAACAGTGCCTGG - Intronic
982091194 4:151881288-151881310 CTAGCACTTAGAACAGTGCCTGG - Intergenic
982231610 4:153213095-153213117 AAAGCACTTAGAACAGTTCCTGG - Intronic
982240882 4:153298175-153298197 GAAGAACTTAGAACAGTGCCTGG + Intronic
982400347 4:154959858-154959880 AAAGCAGTTAGAATAATGCCTGG + Intergenic
982548525 4:156765886-156765908 AAAACACTTAGAATTAAGCCTGG - Intronic
982624783 4:157752970-157752992 GAAATACTTAGAACAGTGCCTGG + Intergenic
982715383 4:158801653-158801675 GAAACACATAGAACGATGCTTGG + Intronic
983816854 4:172140458-172140480 TAAGCCCTTAGAACAATGACTGG - Intronic
983842282 4:172472170-172472192 GCAACTCTTAGACCTATGCCTGG - Intronic
984024634 4:174528486-174528508 GAAGCACCCAGTACAATGCCTGG + Intergenic
984229681 4:177079718-177079740 AAATCACTTAGAACAATGTCTGG + Intergenic
984264751 4:177484638-177484660 AAGGCACTTAGAACAGTGCCTGG + Intergenic
984461245 4:180039886-180039908 AAAGCATTTATAACAATGCCTGG - Intergenic
984585476 4:181559599-181559621 GAAACATTTAGAACAGTGCCTGG + Intergenic
984730388 4:183063034-183063056 AAAGCACTTAGAACAGAGCCTGG - Intergenic
984821708 4:183888286-183888308 GAACTGCTTAGAACAATGCCTGG - Intronic
985023505 4:185716410-185716432 GAAGCACTTAGAAGTGAGTCTGG + Intronic
985136699 4:186793340-186793362 AAAGCACTTAGACCAATGCCAGG - Intergenic
985354284 4:189100745-189100767 CAAGCACTCAGAATGATGCCTGG + Intergenic
985550859 5:532922-532944 GATGCACTTTGAGCTGTGCCAGG - Intergenic
986150361 5:5123389-5123411 AAAGAACTTAGAACAATACCTGG - Intergenic
986336715 5:6760832-6760854 GAAGCACCTGGAGCCATGCCAGG + Intergenic
986355800 5:6924571-6924593 AAAGCATTTAGAACAATGCTTGG + Intergenic
986403392 5:7401157-7401179 AAAGCCCTTAGAACAATGCCTGG + Intronic
986442634 5:7795228-7795250 GAAGCTCTTAGAACTGTGCATGG + Intronic
986445563 5:7818035-7818057 GAAGCTCTTAGAACTCTGAATGG - Intronic
986564818 5:9101449-9101471 GAAGCACTTTAAACAATACCTGG + Intronic
986593643 5:9397459-9397481 AAAACACTTAGAACAGTGCCAGG + Intronic
986653435 5:9987827-9987849 CAAGCACTTAGAACAGTACCTGG - Intergenic
986692366 5:10324014-10324036 TAAGTGCTTAGAACAATGCCTGG + Intergenic
986705800 5:10453841-10453863 GCAGCACTTAGAACAGGGCCTGG - Intronic
987005188 5:13703267-13703289 GAAGTGCTTAGAACAGTGCCTGG - Intronic
987156923 5:15097850-15097872 AAAGCACTTAGTACAGTGCCTGG - Intergenic
987193825 5:15505196-15505218 CAAGTCCTTAGAATTATGCCCGG - Intronic
987360512 5:17102401-17102423 AAAGCCCTTAGAACAATGCTGGG - Intronic
987926228 5:24345390-24345412 GAAGCAATTTAAAATATGCCAGG + Intergenic
988124581 5:27013015-27013037 GAGGCACTTAGGACAAGGCCTGG - Intronic
988422933 5:31028353-31028375 AAAGCATTTAGTACAATGCCTGG + Intergenic
988441008 5:31232836-31232858 AAAACTCTTAGAACAATGCCTGG - Intronic
988555782 5:32234716-32234738 GAAGCTCTTAGACCAATGCTTGG + Intronic
988631759 5:32938926-32938948 AAAGCACTTAGTACAGTGCCTGG - Intergenic
988989805 5:36659322-36659344 GAAGCACTCAGCACAGTGCCTGG + Intronic
989052643 5:37336490-37336512 AAAGCACTCAGAACAATGCCTGG - Intronic
989782623 5:45287499-45287521 GAATTACTTAGCACAATGCCTGG + Intronic
990170828 5:53047890-53047912 AAAACACTAAGAACAATGCCAGG - Intronic
990183087 5:53184287-53184309 GAAGCACTTAGCACAGTGTCTGG - Intergenic
990343262 5:54846200-54846222 AAAGCGCATAGAACAATGCCAGG + Intergenic
990627705 5:57633187-57633209 TAAGCACTTAGAACAGGGCCTGG - Intergenic
990706365 5:58534274-58534296 AAAGTACTTAGAACTGTTCCTGG + Intergenic
990747065 5:58969154-58969176 CTAGCACTTAAAACTATGCCTGG - Exonic
990862581 5:60343503-60343525 AAAGCATTTAGAACAGTGCCTGG - Intronic
990978557 5:61580640-61580662 TAAGCACTTAGAAAAGTGCCTGG + Intergenic
991008942 5:61861330-61861352 CAAGCATTTAGACCAATGCCAGG - Intergenic
991037025 5:62137694-62137716 TAAGCACTTAGAACAGTGTCTGG - Intergenic
991124191 5:63051116-63051138 GAAGCACTTGGCACAATGCCAGG - Intergenic
991471199 5:66970742-66970764 GCAGCACTAAGAACAGTGCCAGG - Intronic
991565277 5:67998320-67998342 GAAGCTCTTAGAACTTTCGCTGG + Intergenic
991598242 5:68326377-68326399 AAAGCACTGAGAATAATGCCTGG - Intergenic
991642659 5:68770266-68770288 CAAGCATTTAGAACAGTGCCTGG - Intergenic
991659921 5:68940399-68940421 AAAGCACTTAGAATAGTGCCTGG + Intergenic
991906654 5:71520676-71520698 TCAGCACTTAGAACAATGCCTGG - Intronic
992158283 5:73975950-73975972 GAAGAGCTTAGAATAATGCCTGG + Intergenic
992209850 5:74468077-74468099 GAAGCACTTAGAGTTCTGCCTGG - Intergenic
992264974 5:75009437-75009459 CTACCACTTAGAACAATGCCTGG - Intergenic
992578771 5:78149574-78149596 GAAGCACTTAGAACAGTGCTCGG - Intronic
992650885 5:78858838-78858860 GAAACATTTAGCACCATGCCTGG - Intronic
992691687 5:79246903-79246925 AAAGCACTCAGAACAGTGCCTGG + Intronic
992783608 5:80149766-80149788 GAAGAACTTAGAACAGTGCCTGG + Intronic
992841264 5:80697347-80697369 GAAGCACTTAAAATTATATCAGG - Intronic
993089048 5:83400965-83400987 AAAGCACTTAAAACAATGTCTGG - Intergenic
993176549 5:84494041-84494063 AAAGAACTTAGAATGATGCCTGG - Intergenic
993274530 5:85839271-85839293 AAAGCACTTAGAACAGTGCCTGG - Intergenic
993383047 5:87229927-87229949 GAATCACTAAGAACAATGACAGG + Intergenic
993921554 5:93811000-93811022 AAAGCACTTAAAACAACGCCTGG + Intronic
993956702 5:94243155-94243177 AAAACACTTAGAACAATGCCTGG + Intronic
994118137 5:96084023-96084045 AAAGCATTTAGAACAATGCCTGG + Intergenic
994128014 5:96191337-96191359 AAAGTACTTAGAACAATGCCTGG - Intergenic
994203623 5:97007460-97007482 GAAGCACCTAGAACAATGCCTGG + Intronic
995238775 5:109861535-109861557 AAAGCACTTGGCACAATGCCTGG - Intronic
995610057 5:113899678-113899700 CAAGCACTAAGAACAATGTCTGG + Intergenic
996205098 5:120724464-120724486 TAAGCACTTAGAATAGTGCCTGG + Intergenic
996408718 5:123132021-123132043 AAAGCACTTAGAACAGTGCCTGG + Intronic
996414970 5:123200650-123200672 AAAGCACTTAGGACAGTGCCTGG - Intergenic
996556111 5:124780708-124780730 TCAGCACATAGAACTATGTCTGG - Intergenic
996836192 5:127795413-127795435 GAGACACTTAGAACAATGCCTGG - Intergenic
997159381 5:131591400-131591422 AAAGCTCTTAGAACAGTGCCTGG - Intronic
997203667 5:132028077-132028099 TAAGCACTTAGAACAGTGTCTGG + Intergenic
997276340 5:132595296-132595318 AAAGCCCTTAGAACAGTGCCTGG + Intronic
997428064 5:133817823-133817845 AAAGCACTTAGTACTGTGCCAGG - Intergenic
997767845 5:136523223-136523245 AAAGCACTTAGAGGTATGCTGGG + Intergenic
997805962 5:136918094-136918116 AAAGCACCTAGCACCATGCCAGG + Intergenic
997851521 5:137337036-137337058 CAAGCACCTAGAACAGTGCCTGG + Intronic
997869181 5:137491972-137491994 GAAGCTCTTAGCACAATGCCTGG - Intronic
997940208 5:138150468-138150490 AAAGCACTTAGCACAGTGCCTGG - Intronic
998050703 5:139030791-139030813 GAAACATTTAGAATTATGCCGGG - Intronic
998326229 5:141282350-141282372 CGAGTACTAAGAACTATGCCTGG - Intergenic
998380141 5:141718580-141718602 AAAACACTTAGAACAATTCCTGG - Intergenic
998387384 5:141765480-141765502 GAAGCACTTAGCATAGTGCCTGG - Intergenic
998418237 5:141960656-141960678 AAAGCACTTAGGACAAGGCCTGG - Intronic
998425355 5:142022131-142022153 AAAGCCCTTAGAACAGTGCCCGG + Intergenic
998495066 5:142581583-142581605 GAAGTGCTTAGCACCATGCCTGG + Intergenic
998800090 5:145860287-145860309 GAAGCACTTAGAACAGCACCTGG - Intronic
998801036 5:145869521-145869543 GAAGCTCTTAGCATTGTGCCTGG - Intronic
998812180 5:145977415-145977437 AAAGCCCCTAGAACTGTGCCTGG - Intronic
998874243 5:146583340-146583362 AAAGCTCTTAGAAGGATGCCTGG - Intronic
998889782 5:146733988-146734010 AAAGCACTTAAAACAATTCCTGG - Intronic
998906466 5:146910625-146910647 TAAGCACTTAGAATATTGCCTGG + Intronic
999046184 5:148472257-148472279 CTAGCACTTAGCACAATGCCTGG + Intronic
999088782 5:148916695-148916717 GAAGCACTTAGCCCAGTGCCTGG - Intergenic
999117273 5:149174925-149174947 GAAGCGCATAGCACAATGCCTGG + Intronic
999202838 5:149828451-149828473 AAAGCACTTAGAACAGTGCCTGG + Intronic
999272993 5:150308523-150308545 GAAGCTCTTAGCACAGTGCCTGG + Intronic
999511654 5:152258638-152258660 GAAACACTTAGAACAGTACCTGG - Intergenic
999640492 5:153667575-153667597 TAAGCACTTAGTACCATGTCTGG - Intronic
999817658 5:155193516-155193538 GAAGCACTTAGAACAGTGCCTGG - Intergenic
999829066 5:155301944-155301966 AAAGCCCTTAGAACAATACCTGG + Intergenic
999833092 5:155339256-155339278 CAACCACCTAGAACAATGCCTGG - Intergenic
999910321 5:156190565-156190587 CAAGCACCTGGAATTATGCCAGG - Intronic
1000037301 5:157459282-157459304 TCAGCACTTAGAACTCTGCCTGG + Intronic
1000116726 5:158160721-158160743 GAAGTGCTTAGAACACTGCCAGG - Intergenic
1000160009 5:158587938-158587960 GCAGCACTTAGAACAGTGCCTGG - Intergenic
1000255841 5:159537464-159537486 AAGGCACTTAGAACAGTGCCTGG - Intergenic
1000299637 5:159944644-159944666 GAGGCACTTAGCACAGTGCCTGG - Intronic
1000321048 5:160134649-160134671 AAATCACTTAGCACTGTGCCTGG + Intergenic
1000611664 5:163381731-163381753 AAAGCATTTAGCAATATGCCTGG + Intergenic
1000639211 5:163681605-163681627 CAAGCTCTTAGAATAATGCCTGG - Intergenic
1001082085 5:168674878-168674900 GAACCACTTAGCACCATGTCTGG - Intronic
1001118630 5:168960380-168960402 CAAACACTTAGAACAATTCCTGG - Intronic
1001200115 5:169708316-169708338 AAAGCACTTAAAACAGTGCCTGG - Intronic
1001386194 5:171341300-171341322 GAAACACTTAGAACAGTGCCTGG - Intergenic
1001448996 5:171809694-171809716 AAAGCACTTAGCACTGTGCCTGG + Intergenic
1001453109 5:171841237-171841259 AAAGCACTTAGAACCGTGTCTGG + Intergenic
1001588101 5:172846838-172846860 AAAGCCCTTAGAACTGTGCCTGG + Intronic
1001752740 5:174143983-174144005 GAAGCACTTAGCACAGTGCCTGG - Intronic
1003325481 6:5086902-5086924 CAAGGCCTTAGAACCATGCCCGG - Exonic
1003818721 6:9871087-9871109 AAAGCACTTAAAACAATGCCTGG + Intronic
1003899710 6:10642952-10642974 AAAGCACTTAGCACAGTGCCTGG - Intergenic
1003947905 6:11092206-11092228 CCAGCACTTAGAACAGTGCCTGG + Intergenic
1004077881 6:12361880-12361902 GGAGCACTTAGAAAAATACCTGG - Intergenic
1004229313 6:13816914-13816936 AAAGCACTTAGCACAGTGCCTGG + Intergenic
1004314437 6:14573558-14573580 AAAGTGCTTAGAACCATGCCAGG - Intergenic
1004321461 6:14634667-14634689 GAAGAATTTAGAACTGTGTCAGG - Intergenic
1004761009 6:18665890-18665912 AAAGCACTTAGCACAATACCTGG - Intergenic
1005077949 6:21926971-21926993 GAAGCACTTGCCACCATGCCTGG + Intergenic
1005176285 6:23048335-23048357 AAAGCACTTAGTACAATGCTTGG - Intergenic
1006239822 6:32667869-32667891 AAAGCAATTAGAACAACGCCTGG + Intronic
1006449056 6:34095558-34095580 AAAGCACTCAGAACAGTGCCTGG + Intronic
1006449340 6:34097056-34097078 CCAGCCCTCAGAACTATGCCTGG - Intronic
1006456709 6:34136111-34136133 AAAGCACTTAGAACAGTGCTTGG - Intronic
1006500328 6:34454709-34454731 CCAGCACTTAGAACAGTGCCTGG + Intergenic
1006647025 6:35521867-35521889 AAAGCACTTAGAGCAGTGCCTGG - Intergenic
1006828860 6:36956768-36956790 AAAGCACTCAGAAGAATGCCTGG + Intronic
1006915138 6:37589030-37589052 GCAGTGCTTAGAACTGTGCCTGG - Intergenic
1007013337 6:38438693-38438715 CTAGCACCTAGAACTATACCTGG - Intronic
1007104040 6:39271137-39271159 GAAGAACCTAGATCTGTGCCTGG - Intergenic
1007261980 6:40570312-40570334 AAAGCACTTAGAACAGTGTCTGG - Intronic
1007267954 6:40611427-40611449 TAAGCACCTAGTACAATGCCTGG - Intergenic
1007299521 6:40856308-40856330 GAAGCACTTAGCACAATACCTGG + Intergenic
1007308532 6:40926322-40926344 AAAGCACTTAGTACAGTGCCTGG + Intergenic
1007481696 6:42154409-42154431 AAAGCACTTAGGACAGTGCCTGG - Intergenic
1007729842 6:43939189-43939211 GAAACACTTAGAATGGTGCCTGG - Intergenic
1007758664 6:44118318-44118340 AAAGCACTTAGCACAGTGCCTGG + Intronic
1007933475 6:45713128-45713150 CAAGCACTCAGCACCATGCCTGG - Intergenic
1008438579 6:51505581-51505603 GAAGCTCTCAGAACAGTGCCTGG - Intergenic
1008690671 6:53975190-53975212 GAGAGACTTAGAACAATGCCTGG - Intronic
1009822274 6:68818357-68818379 AAAGCATTTAGCACTATGCCTGG + Intronic
1010265189 6:73857743-73857765 AAAGAACTTAGAACAATGCCGGG - Intergenic
1010348464 6:74841380-74841402 AAAGCACTTAGTATAATGCCAGG - Intergenic
1010368134 6:75076310-75076332 AAGGCACTTAGTACCATGCCAGG + Intergenic
1010512121 6:76733046-76733068 GAAGCACTTAGTTGCATGCCTGG - Intergenic
1011145949 6:84217138-84217160 CCAGCATTTAGAACAATGCCTGG - Intronic
1011450371 6:87485467-87485489 GAAGAACTTAGATCTTGGCCAGG + Intronic
1011494606 6:87925827-87925849 GAAGCACCTGGCACTATGTCTGG - Intergenic
1011750221 6:90447923-90447945 TAAACACTTAGCACCATGCCTGG - Intergenic
1012042529 6:94227066-94227088 AGAGCACTTAGAATGATGCCTGG - Intergenic
1012197248 6:96358745-96358767 TAAACACTTAGAACAATGCCTGG + Intergenic
1013376947 6:109526641-109526663 GAAGCCCTGAGAACTCTGACAGG - Intronic
1013652015 6:112205162-112205184 GAAACACTTAGAACAATGCCAGG + Intronic
1013673715 6:112433915-112433937 AAAGCACTTAGAATGCTGCCCGG + Intergenic
1013890875 6:115025486-115025508 TAACCCCTTAGTACTATGCCTGG - Intergenic
1013912358 6:115292124-115292146 AAAGATCTTAGAACTGTGCCAGG - Intergenic
1014026331 6:116650544-116650566 AAAGTACTTAGAACTGTGACTGG - Intronic
1014087141 6:117359311-117359333 AATGCACTTAGCACAATGCCTGG - Intronic
1014460374 6:121687566-121687588 GAAACATTTAGAACTGTGTCTGG - Intergenic
1014649317 6:124016697-124016719 GAAGGATTTAAAACTATGCTTGG - Intronic
1014773607 6:125484476-125484498 CCAGCACTTGGAACAATGCCTGG - Intergenic
1014863470 6:126498667-126498689 AAAGTACTTGGAACTATGTCTGG - Intergenic
1015031320 6:128599214-128599236 TAAGCACTTAGGACAATGCTTGG + Intergenic
1015334834 6:132025032-132025054 TAAGCACTTAGAACAATACTTGG - Intergenic
1015665425 6:135622934-135622956 TAAACACTTAGAACTGTGCCAGG - Intergenic
1015741878 6:136464801-136464823 CAAGCACGTAGAACAGTGCCTGG - Intronic
1015892374 6:137981573-137981595 AAAGAATTTAGAACTGTGCCTGG + Intergenic
1016079421 6:139837620-139837642 AAAACCCTTAGAACTATGCATGG - Intergenic
1016158958 6:140852156-140852178 GAAGTACTCAGAACAATGTCTGG - Intergenic
1016384904 6:143521346-143521368 AAAGCACTTAGAACACTACCTGG - Intergenic
1016430674 6:143981990-143982012 CCAGCACCTAGAACAATGCCAGG - Intronic
1016451793 6:144190365-144190387 AAAGCACCTAGAACAGTGCCTGG + Intergenic
1016597789 6:145820991-145821013 AAAGTACTTAGAACAGTGCCTGG + Intergenic
1016812745 6:148276983-148277005 GAAGAGCTTAGAACAGTGCCTGG - Intronic
1016925243 6:149338961-149338983 ACAGCACTTAGAACAGTGCCTGG - Intronic
1017174827 6:151493406-151493428 GAAGCACTTAGAACAGTGCATGG + Intergenic
1017676572 6:156820380-156820402 CTAGCACTTAGTACAATGCCTGG - Intronic
1017687059 6:156924062-156924084 CAAGCAATTAGCACTGTGCCTGG - Intronic
1017979427 6:159386628-159386650 CAAGCATTTAGAACAACGCCTGG - Intergenic
1018194407 6:161342457-161342479 GAAGCACTTGGAAGCATGCCTGG - Intergenic
1018245848 6:161823075-161823097 GAAGCACATGCTACTATGCCAGG + Intronic
1019152448 6:170017893-170017915 GACGCACTCAGAACAATGCATGG + Intergenic
1019545133 7:1570436-1570458 AAAGCGCTTAGAGCGATGCCTGG - Intronic
1019664546 7:2244933-2244955 GAAGGACTTAGAACGGTGCGCGG + Intronic
1019856799 7:3617266-3617288 CTAGCACCTAGAACAATGCCAGG - Intronic
1020935069 7:14453079-14453101 AAAGCACTAAGAACAGTGCCTGG - Intronic
1020968859 7:14907495-14907517 GAAGCACATAGCACAGTGCCTGG + Intronic
1021026734 7:15677281-15677303 AAAGCAATTAGAACAATGTCTGG - Intronic
1021228724 7:18059633-18059655 AAAGCTCTTGGTACTATGCCTGG - Intergenic
1021441547 7:20682667-20682689 GAAGCACCTAAGACAATGCCTGG + Intronic
1021459077 7:20865434-20865456 AAAGCATTTAGAACAATGGCTGG - Intergenic
1021989703 7:26129812-26129834 AAAGCACTTAGAACAGTGCCTGG - Intergenic
1022318950 7:29270154-29270176 GAAGCATTTAGCTCAATGCCTGG - Intronic
1022331332 7:29382114-29382136 AAAGTGCTTAGAACAATGCCTGG + Intronic
1022385164 7:29892529-29892551 AAAGCACCTAGAACAGTGCCAGG - Intronic
1022419719 7:30209197-30209219 CAAGGACTTAGAACAGTGCCTGG + Intergenic
1022515562 7:30972892-30972914 AAAGCACTTAGTGCAATGCCTGG - Intronic
1022805457 7:33816846-33816868 GAAGAGTTTAGAACTGTGCCTGG - Intergenic
1022886184 7:34646991-34647013 AAAGCACTTAGAATAATGCCTGG - Intergenic
1023294779 7:38703147-38703169 GAAGCATTTAGAACAATGACTGG - Intergenic
1023297798 7:38734334-38734356 GAAAAACTTAGAACTATGGAAGG - Intronic
1024161467 7:46680659-46680681 GAATCACTTAGAAGGAGGCCTGG + Intronic
1024317828 7:48037299-48037321 AAAGCACTTAGAACAGTGCCTGG - Intronic
1026172857 7:67969726-67969748 AAAGCAATTAGAACTGTGTCTGG + Intergenic
1026229947 7:68473961-68473983 AAAGCACTTAGAACCACTCCTGG + Intergenic
1026257892 7:68728524-68728546 AAAGCACTTAGAACAATGCCTGG - Intergenic
1026280024 7:68914052-68914074 CAGGCACTTAGAACAGTGCCTGG - Intergenic
1026331834 7:69358808-69358830 AAAGCCCTTAGTACTCTGCCAGG + Intergenic
1026375128 7:69742417-69742439 AAAGCCCTTAGCACTATGCTTGG + Intronic
1027160828 7:75800867-75800889 GAAGCACTAAGCCCAATGCCTGG - Intergenic
1027759521 7:82260249-82260271 AAAACACTTAGAACAATGCCTGG + Intronic
1028002024 7:85510750-85510772 CAAGCACTTAGAACAGTGCCTGG - Intergenic
1028647852 7:93118775-93118797 GAAACATTTAGAACAATGCCTGG - Intergenic
1028711082 7:93908985-93909007 AAAGCTCTGAGAACAATGCCTGG + Intronic
1028748597 7:94356180-94356202 GAGACACTTAGAACAGTGCCTGG - Intergenic
1028753384 7:94408225-94408247 GAAGCACTTACAGCTGGGCCAGG - Exonic
1029860907 7:103570924-103570946 AAAGCACCTAGAACAATGTCTGG + Intronic
1029883310 7:103839719-103839741 GAAGCACTTAGAGTAGTGCCAGG - Intronic
1029982722 7:104894286-104894308 AAAGCACTTAGCACAATGCCTGG + Intronic
1030378877 7:108788287-108788309 GAAGTACTTAAAATTATGCTGGG + Intergenic
1030416910 7:109256821-109256843 AAAGCTCTTAGAACAGTGCCTGG - Intergenic
1030916423 7:115319877-115319899 GCAGCAGTTAGAACAGTGCCTGG + Intergenic
1030926293 7:115459565-115459587 AAAGCACTTAAAACAATACCTGG - Intergenic
1030964587 7:115974913-115974935 AAAGCACTTAGAAGCATGCCTGG - Intronic
1031020644 7:116624325-116624347 CAAGTACTTAGAACTGTGCCTGG - Intergenic
1031434404 7:121714553-121714575 GAATCACTTTGAACCATTCCTGG - Intergenic
1031487185 7:122341786-122341808 GAAGCACCTAGAACATTTCCTGG + Intronic
1031667793 7:124506065-124506087 AAAGAATTTAGAACTGTGCCTGG + Intergenic
1031850128 7:126853489-126853511 GAAGCAGTTAGGACTCTTCCTGG + Intronic
1031893252 7:127319851-127319873 AAAGCACTTAGAAGAATGCTTGG - Intergenic
1032027301 7:128454195-128454217 AAAGCGCTTAGAACAATGCCTGG - Intergenic
1032064702 7:128758390-128758412 TAAGTGCTTAGAACAATGCCTGG - Intronic
1032079299 7:128850718-128850740 GAAGCACTCAGGACCAGGCCTGG + Intronic
1032102202 7:128990456-128990478 GCAGCACCTAGAACAGTGCCTGG + Intronic
1032259172 7:130321050-130321072 CAGGCACATAGCACTATGCCCGG - Intronic
1032598521 7:133267660-133267682 TAGGCCCTTAGAACTGTGCCTGG + Intronic
1032886495 7:136144967-136144989 CAAGCTCCTAGAACTCTGCCTGG + Intergenic
1033302970 7:140202590-140202612 AAAGCAGTTAGAGCAATGCCTGG + Intergenic
1033371868 7:140716377-140716399 AAAGCTCTTAGAACTAGGCCTGG + Intronic
1033480480 7:141735571-141735593 TAAGCACATACCACTATGCCTGG + Intergenic
1033767753 7:144513058-144513080 CAAGTATTTAGAACAATGCCTGG - Intronic
1033923840 7:146431557-146431579 AAAGCATATAGAAATATGCCTGG - Intronic
1034252799 7:149705924-149705946 TAAACACTTAGACCAATGCCTGG + Intergenic
1034396743 7:150831736-150831758 GAAGCACTTAGCACAGTGCCGGG + Intronic
1036242907 8:7093927-7093949 GAAGCACTTAGCGTTGTGCCTGG + Intergenic
1036257892 8:7220101-7220123 GAAGCACTTAGCGTTGTGCCTGG - Intergenic
1036259140 8:7227099-7227121 GAAGCACTTAGCGTTGTGCCTGG - Intergenic
1036307487 8:7612422-7612444 GAAGCACTTAGCGTTGTGCCTGG + Intergenic
1036309939 8:7678697-7678719 GAAGCACTTAGCGTTGTGCCTGG - Intergenic
1036311193 8:7685694-7685716 GAAGCACTTAGCGTTGTGCCTGG - Intergenic
1036358333 8:8060406-8060428 GAAGCACTTAGCGTTGTGCCTGG + Intergenic
1036359594 8:8067405-8067427 GAAGCACTTAGCGTTGTGCCTGG + Intergenic
1036829821 8:12013217-12013239 GAAGCACTTAGCGTTGTGCCTGG - Intronic
1036891363 8:12599547-12599569 GAAGCACTTAGCGTTGTGCCTGG - Intergenic
1036892618 8:12606537-12606559 GAAGCACTTAGCGTTGTGCCTGG - Intergenic
1036898916 8:12657509-12657531 GAAGCACTTAGCGTTGTGCCTGG - Intergenic
1036900170 8:12664525-12664547 GAAGCACTTAGGATTGTGCCTGG - Intergenic
1036961279 8:13247432-13247454 AAAGCACTTAGAATGCTGCCTGG - Intronic
1037507669 8:19547980-19548002 GAATCACTTAATACAATGCCGGG - Intronic
1037546326 8:19927092-19927114 GAAGCTTTTAGAACAATGCCTGG + Intronic
1037934148 8:22903364-22903386 AAAGCACTTAGAACAGTGTCTGG + Intronic
1038324496 8:26562317-26562339 AAAGCACTGAGAACAATGCCTGG + Intronic
1038398332 8:27263497-27263519 AAATCACTTAGAACATTGCCTGG + Intergenic
1038484954 8:27928387-27928409 GAAGCACTTAGAACAGTGCTTGG - Intronic
1038682048 8:29677788-29677810 GAACCACTTAGCACAATGCCTGG - Intergenic
1038967052 8:32586075-32586097 AAAGCTCTTAGAACAATGCCTGG + Intronic
1038991268 8:32870966-32870988 GAAACATTTAGAACAATTCCTGG - Intergenic
1039188795 8:34948336-34948358 GAAGCACTTAGAACAGTGCCTGG - Intergenic
1039509329 8:38078288-38078310 TAGGCACCTAGAACCATGCCTGG - Intergenic
1039539602 8:38352992-38353014 CAAGCACTTAGAATGGTGCCTGG - Intronic
1039589194 8:38732623-38732645 GAAGCACTTAGCACAATGCCTGG - Intronic
1040834026 8:51712524-51712546 CAAGCACCTAGAATCATGCCTGG + Intronic
1041076255 8:54172893-54172915 AAAGAACTTAGACCTAGGCCTGG - Intergenic
1041184319 8:55283247-55283269 AAAGCACTTAGCACCATGCCAGG - Intronic
1041230562 8:55746868-55746890 ATAGCACCTAGAACTGTGCCTGG + Intronic
1041753433 8:61286552-61286574 CAAGCACTTACAAGTATGCCTGG - Intronic
1041787193 8:61648176-61648198 AAAACACTTAGAAAAATGCCTGG + Intronic
1041825283 8:62088695-62088717 AAAGCACTTAGATCAATGCCTGG - Intergenic
1042211069 8:66381161-66381183 AAAGCTCTTAGAACTATGCCAGG - Intergenic
1042648393 8:71012641-71012663 GAAGTACTTAGTACAATGCCTGG - Intergenic
1042806608 8:72777258-72777280 GTAGCACTTACAAATATGCAAGG - Intronic
1042849077 8:73197930-73197952 CCAGCACCTAGAACAATGCCTGG + Intergenic
1042858100 8:73287422-73287444 CTGGCACTTAGAACAATGCCTGG - Intergenic
1042868360 8:73375871-73375893 AAAGCACTTAGAAGAATGCCTGG + Intergenic
1043053798 8:75411912-75411934 GAAACATTTAGAACAGTGCCTGG + Intronic
1043146361 8:76660690-76660712 AAAGCACTTATCACCATGCCTGG + Intergenic
1043166897 8:76914323-76914345 GAGGCACTTAGAAGACTGCCTGG - Intergenic
1043383825 8:79729831-79729853 GAAGCACTTAGAAGAGTGTCTGG + Intergenic
1043510021 8:80941192-80941214 CTAGCACTTAGAACAATGCTTGG - Intergenic
1043962358 8:86431949-86431971 GAAGTACTTAGAACAATCCTCGG - Intronic
1043977875 8:86603533-86603555 AAAGCACTTAGAACACTGCCTGG - Intronic
1044454172 8:92373086-92373108 GAAGCACGTAGAACAGTGCCTGG - Intergenic
1044707867 8:95025654-95025676 AAAGCATTTAGAACAATTCCTGG + Intronic
1044717095 8:95110488-95110510 AAAGCACTTAGAATAGTGCCTGG - Intronic
1044791659 8:95853599-95853621 GAAGTATTTAGAAGAATGCCTGG + Intergenic
1044804226 8:95988398-95988420 GAAGCACTTAGAAGAGTGCCTGG - Intergenic
1044833171 8:96269943-96269965 AAAGCACTTAAAACAGTGCCTGG - Intronic
1044871262 8:96622140-96622162 AAAGCACTTAGAACAATGCCTGG + Intergenic
1044872051 8:96629006-96629028 AAAGCACTTAGAATGGTGCCTGG - Intergenic
1045135844 8:99217226-99217248 GAAGCCCTTAGAACAGTGCCAGG - Intronic
1045169198 8:99644872-99644894 AAAGCAGTTAGGACAATGCCTGG - Intronic
1045359187 8:101416313-101416335 AAAGCACTTAGCACAGTGCCTGG + Intergenic
1045367386 8:101489429-101489451 GAACCACTTAGAACATTACCAGG - Intergenic
1045373073 8:101544486-101544508 CAAGCATAAAGAACTATGCCTGG + Intronic
1045505550 8:102775855-102775877 AAAGCACTTAGCACCATGCCTGG + Intergenic
1045520602 8:102899785-102899807 ACAGGACTTAGAACAATGCCTGG - Intronic
1045774088 8:105781345-105781367 GAAGTGCTTAGAACAGTGCCTGG + Intronic
1046034902 8:108828879-108828901 GAAGTACTTAGAATAGTGCCTGG - Intergenic
1046098884 8:109592057-109592079 AAAGAAATTAGAACAATGCCTGG + Intronic
1046687066 8:117239438-117239460 GAAACCCTTAGCACCATGCCTGG + Intergenic
1046717611 8:117584757-117584779 TAAGTGCTTAGAACGATGCCTGG - Intergenic
1046812163 8:118544876-118544898 GAAGCACCTAGCACAATGCCTGG - Intronic
1046833684 8:118775895-118775917 TAAGCACTTAGAACTATGCAAGG + Intergenic
1046849822 8:118959506-118959528 AAGGCACTTAGAGCAATGCCTGG + Intergenic
1047074218 8:121381772-121381794 AAAGCACTTAGAACAAAGCCTGG - Intergenic
1047204594 8:122793130-122793152 GAAGCATTTAGCACAGTGCCTGG + Intronic
1047221002 8:122918101-122918123 GAGGCACTTAGAATGGTGCCTGG - Intronic
1047307938 8:123668388-123668410 ACAGCACCTAGAACAATGCCTGG - Intergenic
1047404684 8:124575433-124575455 GAAGCATTCAGAACAACGCCCGG + Intronic
1047477937 8:125253022-125253044 AAAGTACTTAGCACTGTGCCTGG + Intronic
1047633042 8:126729006-126729028 AAATCATTTAGAACCATGCCTGG - Intergenic
1047645406 8:126864758-126864780 GAAGTCCTTAGAACAGTGCCTGG + Intergenic
1047655057 8:126968524-126968546 GAAGCACTCCTAACTATGCATGG + Intergenic
1047738011 8:127783568-127783590 AAAGCACTTAGACCAATGTCTGG + Intergenic
1047790729 8:128200854-128200876 GAAGCACTGAGAATAGTGCCTGG - Intergenic
1047870223 8:129074231-129074253 AAAGCACTCAGAACTGTGCCTGG + Intergenic
1047946843 8:129888731-129888753 TGAGCACTTAGAACAATGCCTGG + Intronic
1047990976 8:130286626-130286648 AAAGCACTAAGAACAGTGCCTGG + Intronic
1048003427 8:130398670-130398692 AAAGCACTTGGAACAGTGCCTGG - Intronic
1048010065 8:130448315-130448337 GAAGCACATACTACTATGTCTGG - Intergenic
1048016168 8:130499588-130499610 AAAGCATTTGGAACCATGCCTGG - Intergenic
1048201900 8:132381641-132381663 TAAGCACCTAGAACAGTGCCTGG - Intronic
1048394223 8:133998232-133998254 AAAGCACTTAGCACAATGCGTGG - Intergenic
1048485406 8:134843447-134843469 AAAGCACTTAGAACCATACTTGG - Intergenic
1048608786 8:135999466-135999488 GAAACACTTAGAATTATGATAGG + Intergenic
1048611511 8:136028191-136028213 GAAGCATTTAGAACAGTGCCTGG + Intergenic
1048800930 8:138193279-138193301 CAAGCACTTAGAACTGTGCCAGG + Intronic
1048947879 8:139467144-139467166 AAAGCACTTAGAACAGTGCCTGG + Intergenic
1049159520 8:141088529-141088551 AAAACACTTAGAACAATACCTGG + Intergenic
1049499286 8:142952976-142952998 AAAGCCCTTAGAACAAAGCCTGG + Intergenic
1050150435 9:2614441-2614463 AAAGCATTTAGAACAGTGCCTGG - Intergenic
1050446851 9:5732991-5733013 CAAGTGCTTAGAACTATGGCTGG - Intronic
1050643550 9:7694200-7694222 CAAGCACCCAGAACTATACCTGG - Intergenic
1051093794 9:13441380-13441402 AAAGCACTTAAAACAATGGCTGG - Intergenic
1051248126 9:15132484-15132506 ACAACACTTAGAACAATGCCTGG + Intergenic
1051308233 9:15739580-15739602 AAAGCATTTAGAACAATGCCTGG + Intronic
1051425623 9:16928774-16928796 GAAGTACTTAGAATAGTGCCTGG + Intergenic
1051540324 9:18208550-18208572 GAAGCGCTTAAAACTGTGCCTGG - Intergenic
1051591368 9:18779404-18779426 AAAGCACTGAGCACTATGTCTGG - Intronic
1051612690 9:18976938-18976960 GAAGCACTTAGCACAATGCCTGG + Intronic
1051681515 9:19612284-19612306 AAAGCACTTACAACAAGGCCTGG - Intronic
1051919177 9:22244120-22244142 AATGCACTTAGAACAGTGCCTGG - Intergenic
1051987933 9:23113045-23113067 TAAGCACTTAGAACACTGCCTGG - Intergenic
1052361186 9:27560993-27561015 AAAGCACTTAGAACAGTGCCTGG - Intronic
1052428372 9:28334544-28334566 AAGGCACTCAGAACAATGCCTGG + Intronic
1053066012 9:35069906-35069928 CCAGCCCTTAGAACAATGCCTGG - Intronic
1053168923 9:35864606-35864628 GAAGCTCTTAGAACAGAGCCTGG + Intergenic
1053185296 9:36011237-36011259 CCAGCACCTAGAATTATGCCTGG + Intergenic
1053218410 9:36291971-36291993 CAAGAGCTTAGAACTGTGCCAGG - Intronic
1054845731 9:69795488-69795510 GAAGTACTTAGCACAATACCTGG + Intergenic
1054851332 9:69849449-69849471 CTAGCACTTAGCATTATGCCTGG - Intronic
1054974250 9:71123477-71123499 AAAGCACTTAGAACAGTGCCTGG + Intronic
1055138940 9:72853327-72853349 AAAGTACATAGCACTATGCCTGG + Intergenic
1055425099 9:76186932-76186954 GAAGCCCTTAGAAAAATGCAAGG - Intronic
1055446464 9:76388417-76388439 AAAGCACTTAAAACGGTGCCTGG + Intronic
1055481411 9:76712177-76712199 AAAACCCTTAGAACCATGCCTGG - Intronic
1055697677 9:78904483-78904505 AAAGCACCTAGAACAGTGCCTGG + Intergenic
1056538047 9:87548036-87548058 GAAGTGCTTAGAATAATGCCCGG - Intronic
1056616616 9:88173104-88173126 GAAACACTCAGCACAATGCCTGG - Intergenic
1057067652 9:92070745-92070767 AAAACACTTAGAACACTGCCTGG + Intronic
1057270415 9:93647229-93647251 GAAGAGCTTAGAAAAATGCCTGG - Intronic
1057421309 9:94915223-94915245 AAAATACTTAGAACTTTGCCTGG + Intronic
1057463093 9:95284013-95284035 AAAGCACTTAGAATTGTGCCTGG + Intronic
1057798669 9:98175849-98175871 CAAGCACTTAGAACCCAGCCTGG + Intronic
1057862271 9:98650397-98650419 TAAGTACTTAGAATTGTGCCTGG + Intronic
1057968770 9:99532408-99532430 CAAGCACTTAGCACAGTGCCTGG - Intergenic
1057987095 9:99728197-99728219 GAAGTACTTAGAGCAATGCCTGG - Intergenic
1058045185 9:100350976-100350998 AAAACACTCAGAACTGTGCCTGG + Intronic
1058089431 9:100787601-100787623 GAAGCATTTAGCACAGTGCCTGG + Intergenic
1058332903 9:103786213-103786235 GAAGCATTTAAAACTATAACTGG - Intergenic
1058336773 9:103838893-103838915 CAAGCACTTAGAAATATGCCAGG + Intergenic
1058425663 9:104873756-104873778 GAAGCACTTAGTACAGTGCCTGG - Intronic
1058501680 9:105625615-105625637 AAAGAACTTAGCACCATGCCTGG + Intronic
1058526772 9:105866917-105866939 GGAGCATTTAGTACAATGCCTGG - Intergenic
1058545548 9:106057728-106057750 GAAACACTTAGCACAATGCCTGG - Intergenic
1058602305 9:106683272-106683294 GAAGCACTTATACCATTGCCTGG - Intergenic
1058629610 9:106973100-106973122 GAAGTACTTAGAATAGTGCCTGG + Intronic
1058647839 9:107146944-107146966 AAAGCTCTTAACACTATGCCAGG + Intergenic
1058654998 9:107212275-107212297 AAAGCACTTAGAACAGTGCCTGG - Intergenic
1058729060 9:107832471-107832493 GGAGCACTTGGTACAATGCCTGG + Intergenic
1058917105 9:109578256-109578278 AAAGCACTTAGCACAGTGCCTGG + Intergenic
1059131118 9:111750475-111750497 CAGGCACTTACAACCATGCCTGG + Intronic
1059179341 9:112197223-112197245 GAAGCTCTTAGAATGGTGCCTGG - Intergenic
1059225816 9:112672061-112672083 AAAGCACTTAAAACAATGCCTGG + Intergenic
1059291144 9:113224967-113224989 AAAGCATTTAGAACAGTGCCTGG + Intronic
1059709810 9:116857138-116857160 AAAGCACTTAGAACCGTGCTTGG + Intronic
1059761878 9:117345411-117345433 GAAGCACTTAGAGTCATGCAAGG - Intronic
1059814001 9:117891326-117891348 GAAGCATTTAGTACAGTGCCTGG + Intergenic
1059835323 9:118145745-118145767 TAAGCACTTAGGACAGTGCCTGG + Intergenic
1060243296 9:121923566-121923588 AAAGCACCTGGAACAATGCCTGG - Intronic
1060274109 9:122169293-122169315 GAAGCATTTAGCACAGTGCCTGG - Intronic
1060398136 9:123330595-123330617 AAAGCATTTAGAACAGTGCCTGG - Intergenic
1060400341 9:123344978-123345000 AGAGCACTTAGAATCATGCCTGG + Intergenic
1060584618 9:124778062-124778084 AAAGTACTTAGCACTAGGCCGGG + Intronic
1060689002 9:125639442-125639464 AAAGCACTCAGAATTGTGCCTGG + Intronic
1060885262 9:127147765-127147787 GAAACACTTAGCACGATGCTGGG + Intronic
1060904416 9:127291983-127292005 GAAACTCCTAGCACTATGCCTGG + Intronic
1060988003 9:127831088-127831110 AAAGCACTTAGAACACTGCTGGG - Intronic
1061067723 9:128289067-128289089 AAAGCACTTAGCACAATGCCTGG - Intergenic
1061250791 9:129425159-129425181 AAAGCACTTAGAATGGTGCCTGG - Intergenic
1061303555 9:129720030-129720052 AAAGCGCTTAGAACAATGCCTGG + Intronic
1061353905 9:130088593-130088615 GAAGCACTTAGCACAATGCCTGG - Intronic
1061503126 9:131015013-131015035 GAAGCACTTGGAACAGTCCCAGG - Intronic
1061898203 9:133659409-133659431 GAAGCACTTGGTACCACGCCTGG - Intergenic
1203422179 Un_GL000195v1:3208-3230 GAAAAACTTAGAAACATGCCAGG + Intergenic
1186221930 X:7358325-7358347 GAAGCACTTAGAACCATGTCTGG - Intergenic
1186562712 X:10630114-10630136 TCAGCACCTAGAACAATGCCTGG - Intronic
1186698510 X:12064210-12064232 AAAGTACCTAGAACAATGCCTGG - Intergenic
1186747163 X:12582059-12582081 GCAGTGCTTAGAACAATGCCCGG + Intronic
1186850035 X:13570656-13570678 GAAGTGCTTAGAACAGTGCCAGG - Intronic
1186881794 X:13873649-13873671 TAAGCAATTAGAACCAAGCCTGG + Intronic
1186995625 X:15118543-15118565 AAAACACTTAGAACAATGCCTGG + Intergenic
1187120141 X:16397524-16397546 AAAGCACTTAGAACAGTGCTTGG - Intergenic
1187144947 X:16628947-16628969 GGAGCCCTTAGAACAGTGCCTGG - Intronic
1187199406 X:17120490-17120512 AAAGCACTTAGAATGATGCCTGG + Intronic
1187266165 X:17736613-17736635 AAAGCACTTAGAACAGTACCTGG - Intergenic
1187299733 X:18036516-18036538 AAGACACTTAGAACAATGCCTGG - Intergenic
1187359761 X:18614547-18614569 AAAGCACCTAGAATAATGCCTGG + Intronic
1187564853 X:20438988-20439010 CCAGCACTTAGCACAATGCCTGG - Intergenic
1187942694 X:24397596-24397618 AAAGCACTTAGAACAGTACCTGG - Intergenic
1188240357 X:27779924-27779946 GAAGCACTGAGAATTATAGCTGG + Intergenic
1188319487 X:28718168-28718190 CAAGCACCTACAACTATACCAGG - Intronic
1188402374 X:29761644-29761666 GAAACACTTAGAACATTGCCTGG + Intronic
1188478854 X:30616928-30616950 GAGGCACATACCACTATGCCTGG - Intergenic
1188585595 X:31770819-31770841 GAAGTACTTAGATCAATGACTGG + Intronic
1188934702 X:36159898-36159920 GAAATACTTAGAACTCTGTCTGG - Intergenic
1188960982 X:36491083-36491105 GTAGTACTTAGTACAATGCCAGG - Intergenic
1189036163 X:37495489-37495511 AAATCACTTAGAGCAATGCCTGG + Intronic
1189044523 X:37576299-37576321 GAAACCCTTGGAACTATTCCAGG - Intronic
1189084449 X:38006212-38006234 AAAGCACTTACAACAGTGCCTGG + Intronic
1189137609 X:38565120-38565142 TCAGCACTTAGAACTATGTCTGG + Intronic
1189245368 X:39559225-39559247 GTAACACTTAGAACCATGCCCGG + Intergenic
1189649049 X:43169387-43169409 TCAGCACCTAGAACAATGCCTGG - Intergenic
1189650778 X:43187281-43187303 AAAGAACTTAGAACAATGCAAGG + Intergenic
1189795587 X:44642935-44642957 AAAGCACTTAGAACAATGCCTGG + Intergenic
1190018844 X:46853379-46853401 TCAGCACTAAGAACTGTGCCTGG + Intronic
1190148783 X:47923169-47923191 AGAGCTCTTAGAACTATGCATGG + Intronic
1190328285 X:49219947-49219969 ACAGCACTTAGAACAGTGCCTGG + Intronic
1190476142 X:50829518-50829540 GAAGCATTGAGAATCATGCCTGG + Intergenic
1190476143 X:50829536-50829558 TAAGCACTTAAAAATATTCCAGG - Intergenic
1190580726 X:51891581-51891603 CCAGCACCTAGAACCATGCCTGG - Intronic
1190716941 X:53112733-53112755 GGAGAACTTTGACCTATGCCTGG + Intergenic
1191054008 X:56223279-56223301 GAAGCACCTAGAACAATGACTGG + Intergenic
1192146112 X:68684040-68684062 TAAGCACTTAGAACAATGTCTGG + Intronic
1192189596 X:68982934-68982956 AAAGCACTTAGAGCTGTGCCTGG + Intergenic
1192234588 X:69287642-69287664 AAAGCACTTAGAACATTCCCTGG + Intergenic
1192250129 X:69405898-69405920 GAAGCTCTTTGAACAGTGCCTGG - Intergenic
1192359280 X:70428776-70428798 AAAGTACTTAGAACACTGCCTGG + Intronic
1192594044 X:72387684-72387706 AAAGCACTTAAAACAGTGCCAGG + Intronic
1192676928 X:73207323-73207345 CAAGCACTTAGCACAATGCCTGG - Intergenic
1192762121 X:74104691-74104713 CAAGCACTTAGAGCTGTGCCTGG - Intergenic
1192850567 X:74951772-74951794 CAAGCACTTAGGACAGTGCCTGG - Intergenic
1193041793 X:77011688-77011710 AAAGTACTTAGCACAATGCCTGG + Intergenic
1193186655 X:78521334-78521356 AAAGCCCTTGGAGCTATGCCTGG - Intergenic
1193318550 X:80093546-80093568 AAAGAACTTAGAACAATGCCTGG + Intergenic
1193584724 X:83306983-83307005 GAAGCACTTAGCAAAATGCTTGG - Intergenic
1194265349 X:91746334-91746356 AAAGCACTTAGAACAGTGTCTGG - Intergenic
1194497958 X:94640466-94640488 AAAGAACTTAGAACAGTGCCTGG + Intergenic
1194981551 X:100446203-100446225 AAAGCACTTAGAACTGTCCCTGG - Intergenic
1194982995 X:100459679-100459701 AAAGCACTTAGAATAGTGCCTGG - Intergenic
1195348005 X:103970391-103970413 AAAGCACTTAGAACAATGCCTGG + Intergenic
1195355485 X:104035748-104035770 AAAGCACTTAGAAAAATGCCTGG + Intergenic
1195359437 X:104068450-104068472 AAAGCACTTAGAACAATGCCTGG - Intergenic
1195615724 X:106910322-106910344 AAAGCACTTAGCACGGTGCCTGG - Intronic
1195676098 X:107507979-107508001 TAAGCACTTAGAACTGTGCCTGG - Intergenic
1195708085 X:107752567-107752589 GAAGCACAAAGAGCTATGCCTGG + Intronic
1195715581 X:107815231-107815253 AAAGTGCTTAGAACAATGCCAGG + Intergenic
1195926129 X:110026607-110026629 AAGGCACTTAGGACAATGCCTGG - Intronic
1196100180 X:111839528-111839550 AAAGCACTTAGCACAATGCTTGG - Intronic
1196102081 X:111857061-111857083 GAAGTGCTTAGAACTATGCCTGG + Intronic
1196398058 X:115287194-115287216 AAAGCTCTCAGAACAATGCCGGG + Intergenic
1196936888 X:120739244-120739266 GAGGCAGTTAGAACTAGCCCAGG - Intergenic
1197149745 X:123207317-123207339 AAATCACTTAGAAGGATGCCTGG - Intronic
1197181481 X:123541569-123541591 CCAGCACCTAGAACTATGTCTGG - Intergenic
1197609978 X:128627260-128627282 TAATCACTTAGAATGATGCCTGG - Intergenic
1197752333 X:129973907-129973929 TAAGCACTTAGAACAGTGCCTGG - Intergenic
1197976674 X:132172923-132172945 TAAACACATAGAACAATGCCTGG - Intergenic
1197999495 X:132418329-132418351 AAAGCACTTTGAACAATGCCTGG - Intronic
1198217124 X:134565765-134565787 AAACCACTTAGAACAATGTCTGG + Intergenic
1198253184 X:134902037-134902059 CAAACACTTAGAACATTGCCTGG - Intronic
1198282618 X:135156662-135156684 CAAGCACTTAGAAGAGTGCCTGG - Exonic
1198288341 X:135215860-135215882 CAAGCACTTAGAAGAGTGCCTGG + Intergenic
1198313727 X:135445696-135445718 AAAGCACTTAGAAGAGTGCCTGG - Intergenic
1198417077 X:136431136-136431158 CAAGCACTTAGAACAACACCTGG + Intergenic
1198671492 X:139085408-139085430 AAAGCACATAGCACAATGCCTGG + Intronic
1198689716 X:139267542-139267564 TAAGCTCTTAGCACAATGCCTGG + Intergenic
1198777590 X:140197246-140197268 AAAGCACTTAGCACAAGGCCTGG + Intergenic
1199016959 X:142828968-142828990 GAAGCACTTAGACTAGTGCCTGG - Intergenic
1199092473 X:143707725-143707747 AAAGCACTTAGAACAATTTCAGG - Intergenic
1199103947 X:143839530-143839552 AAAGCACTTAGAACAATTTCAGG - Intergenic
1199243577 X:145576162-145576184 AAAGCACTTAGTACAGTGCCTGG + Intergenic
1199267767 X:145848277-145848299 AAAGCCCTTAGAACAGTGCCTGG + Intergenic
1199449219 X:147960901-147960923 GAAGCACTTAGGCTCATGCCTGG + Intergenic
1199655576 X:149991745-149991767 GAAGCACTTAAAACAAGGCCTGG + Intergenic
1199804115 X:151280825-151280847 AAATCACTTAGATCAATGCCTGG + Intergenic
1199904217 X:152207928-152207950 TAAGCACTTAGAACAGTGACTGG + Intronic
1200368634 X:155696975-155696997 AAAGCACTTAGAATAGTGCCTGG - Intergenic
1200368688 X:155697592-155697614 AAAGCACTTAGAATAGTGCCTGG + Intergenic
1200582500 Y:4966796-4966818 AAAGCACTTAGAACAGTGTCTGG - Intergenic
1201590309 Y:15607460-15607482 AAAGCACTTAGAATCATGTCTGG - Intergenic