ID: 935620311

View in Genome Browser
Species Human (GRCh38)
Location 2:105124285-105124307
Sequence GCACCTATTAAATTTGACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935620305_935620311 25 Left 935620305 2:105124237-105124259 CCTTTAAAAATATGATTTCAAGC No data
Right 935620311 2:105124285-105124307 GCACCTATTAAATTTGACAAGGG No data
935620308_935620311 -6 Left 935620308 2:105124268-105124290 CCATTTCTCTAATCCAAGCACCT No data
Right 935620311 2:105124285-105124307 GCACCTATTAAATTTGACAAGGG No data
935620304_935620311 26 Left 935620304 2:105124236-105124258 CCCTTTAAAAATATGATTTCAAG No data
Right 935620311 2:105124285-105124307 GCACCTATTAAATTTGACAAGGG No data
935620307_935620311 3 Left 935620307 2:105124259-105124281 CCGTGGATTCCATTTCTCTAATC No data
Right 935620311 2:105124285-105124307 GCACCTATTAAATTTGACAAGGG No data
935620303_935620311 27 Left 935620303 2:105124235-105124257 CCCCTTTAAAAATATGATTTCAA No data
Right 935620311 2:105124285-105124307 GCACCTATTAAATTTGACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935620311 Original CRISPR GCACCTATTAAATTTGACAA GGG Intergenic
No off target data available for this crispr