ID: 935626430

View in Genome Browser
Species Human (GRCh38)
Location 2:105175725-105175747
Sequence ACAGCTGGAGAGCCGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935626430_935626438 15 Left 935626430 2:105175725-105175747 CCAGCTTCCGGCTCTCCAGCTGT No data
Right 935626438 2:105175763-105175785 CGAGAGCAGGAAGGGCTCCTAGG No data
935626430_935626437 7 Left 935626430 2:105175725-105175747 CCAGCTTCCGGCTCTCCAGCTGT No data
Right 935626437 2:105175755-105175777 CCACTGAGCGAGAGCAGGAAGGG No data
935626430_935626435 6 Left 935626430 2:105175725-105175747 CCAGCTTCCGGCTCTCCAGCTGT No data
Right 935626435 2:105175754-105175776 ACCACTGAGCGAGAGCAGGAAGG No data
935626430_935626433 2 Left 935626430 2:105175725-105175747 CCAGCTTCCGGCTCTCCAGCTGT No data
Right 935626433 2:105175750-105175772 CTCCACCACTGAGCGAGAGCAGG No data
935626430_935626439 23 Left 935626430 2:105175725-105175747 CCAGCTTCCGGCTCTCCAGCTGT No data
Right 935626439 2:105175771-105175793 GGAAGGGCTCCTAGGCACTGTGG No data
935626430_935626441 27 Left 935626430 2:105175725-105175747 CCAGCTTCCGGCTCTCCAGCTGT No data
Right 935626441 2:105175775-105175797 GGGCTCCTAGGCACTGTGGAGGG No data
935626430_935626440 26 Left 935626430 2:105175725-105175747 CCAGCTTCCGGCTCTCCAGCTGT No data
Right 935626440 2:105175774-105175796 AGGGCTCCTAGGCACTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935626430 Original CRISPR ACAGCTGGAGAGCCGGAAGC TGG (reversed) Intergenic
No off target data available for this crispr