ID: 935627309

View in Genome Browser
Species Human (GRCh38)
Location 2:105181726-105181748
Sequence CATGTCAGAGCCAGGGTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935627309_935627313 -2 Left 935627309 2:105181726-105181748 CCAATAACCCTGGCTCTGACATG No data
Right 935627313 2:105181747-105181769 TGTATTAGCTGTGTGATTTTGGG No data
935627309_935627315 26 Left 935627309 2:105181726-105181748 CCAATAACCCTGGCTCTGACATG No data
Right 935627315 2:105181775-105181797 CAGTTTCCTTATCTGTGAAATGG 0: 22
1: 472
2: 2602
3: 7774
4: 15140
935627309_935627316 29 Left 935627309 2:105181726-105181748 CCAATAACCCTGGCTCTGACATG No data
Right 935627316 2:105181778-105181800 TTTCCTTATCTGTGAAATGGAGG 0: 8
1: 87
2: 386
3: 1439
4: 3345
935627309_935627312 -3 Left 935627309 2:105181726-105181748 CCAATAACCCTGGCTCTGACATG No data
Right 935627312 2:105181746-105181768 ATGTATTAGCTGTGTGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935627309 Original CRISPR CATGTCAGAGCCAGGGTTAT TGG (reversed) Intergenic
No off target data available for this crispr