ID: 935627312

View in Genome Browser
Species Human (GRCh38)
Location 2:105181746-105181768
Sequence ATGTATTAGCTGTGTGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935627305_935627312 26 Left 935627305 2:105181697-105181719 CCGTGTGGACCAAGCATGGGATT No data
Right 935627312 2:105181746-105181768 ATGTATTAGCTGTGTGATTTTGG No data
935627310_935627312 -10 Left 935627310 2:105181733-105181755 CCCTGGCTCTGACATGTATTAGC No data
Right 935627312 2:105181746-105181768 ATGTATTAGCTGTGTGATTTTGG No data
935627307_935627312 17 Left 935627307 2:105181706-105181728 CCAAGCATGGGATTTGGAGACCA No data
Right 935627312 2:105181746-105181768 ATGTATTAGCTGTGTGATTTTGG No data
935627309_935627312 -3 Left 935627309 2:105181726-105181748 CCAATAACCCTGGCTCTGACATG No data
Right 935627312 2:105181746-105181768 ATGTATTAGCTGTGTGATTTTGG No data
935627302_935627312 30 Left 935627302 2:105181693-105181715 CCTGCCGTGTGGACCAAGCATGG No data
Right 935627312 2:105181746-105181768 ATGTATTAGCTGTGTGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935627312 Original CRISPR ATGTATTAGCTGTGTGATTT TGG Intergenic
No off target data available for this crispr