ID: 935627313

View in Genome Browser
Species Human (GRCh38)
Location 2:105181747-105181769
Sequence TGTATTAGCTGTGTGATTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935627310_935627313 -9 Left 935627310 2:105181733-105181755 CCCTGGCTCTGACATGTATTAGC No data
Right 935627313 2:105181747-105181769 TGTATTAGCTGTGTGATTTTGGG No data
935627307_935627313 18 Left 935627307 2:105181706-105181728 CCAAGCATGGGATTTGGAGACCA No data
Right 935627313 2:105181747-105181769 TGTATTAGCTGTGTGATTTTGGG No data
935627309_935627313 -2 Left 935627309 2:105181726-105181748 CCAATAACCCTGGCTCTGACATG No data
Right 935627313 2:105181747-105181769 TGTATTAGCTGTGTGATTTTGGG No data
935627311_935627313 -10 Left 935627311 2:105181734-105181756 CCTGGCTCTGACATGTATTAGCT No data
Right 935627313 2:105181747-105181769 TGTATTAGCTGTGTGATTTTGGG No data
935627305_935627313 27 Left 935627305 2:105181697-105181719 CCGTGTGGACCAAGCATGGGATT No data
Right 935627313 2:105181747-105181769 TGTATTAGCTGTGTGATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935627313 Original CRISPR TGTATTAGCTGTGTGATTTT GGG Intergenic
No off target data available for this crispr