ID: 935627315

View in Genome Browser
Species Human (GRCh38)
Location 2:105181775-105181797
Sequence CAGTTTCCTTATCTGTGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 26010
Summary {0: 22, 1: 472, 2: 2602, 3: 7774, 4: 15140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935627311_935627315 18 Left 935627311 2:105181734-105181756 CCTGGCTCTGACATGTATTAGCT No data
Right 935627315 2:105181775-105181797 CAGTTTCCTTATCTGTGAAATGG 0: 22
1: 472
2: 2602
3: 7774
4: 15140
935627310_935627315 19 Left 935627310 2:105181733-105181755 CCCTGGCTCTGACATGTATTAGC No data
Right 935627315 2:105181775-105181797 CAGTTTCCTTATCTGTGAAATGG 0: 22
1: 472
2: 2602
3: 7774
4: 15140
935627309_935627315 26 Left 935627309 2:105181726-105181748 CCAATAACCCTGGCTCTGACATG No data
Right 935627315 2:105181775-105181797 CAGTTTCCTTATCTGTGAAATGG 0: 22
1: 472
2: 2602
3: 7774
4: 15140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935627315 Original CRISPR CAGTTTCCTTATCTGTGAAA TGG Intergenic
Too many off-targets to display for this crispr