ID: 935627316

View in Genome Browser
Species Human (GRCh38)
Location 2:105181778-105181800
Sequence TTTCCTTATCTGTGAAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5265
Summary {0: 8, 1: 87, 2: 386, 3: 1439, 4: 3345}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935627310_935627316 22 Left 935627310 2:105181733-105181755 CCCTGGCTCTGACATGTATTAGC No data
Right 935627316 2:105181778-105181800 TTTCCTTATCTGTGAAATGGAGG 0: 8
1: 87
2: 386
3: 1439
4: 3345
935627311_935627316 21 Left 935627311 2:105181734-105181756 CCTGGCTCTGACATGTATTAGCT No data
Right 935627316 2:105181778-105181800 TTTCCTTATCTGTGAAATGGAGG 0: 8
1: 87
2: 386
3: 1439
4: 3345
935627309_935627316 29 Left 935627309 2:105181726-105181748 CCAATAACCCTGGCTCTGACATG No data
Right 935627316 2:105181778-105181800 TTTCCTTATCTGTGAAATGGAGG 0: 8
1: 87
2: 386
3: 1439
4: 3345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935627316 Original CRISPR TTTCCTTATCTGTGAAATGG AGG Intergenic
Too many off-targets to display for this crispr