ID: 935627344

View in Genome Browser
Species Human (GRCh38)
Location 2:105182045-105182067
Sequence TCTAATCTTTACAAGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935627344_935627348 23 Left 935627344 2:105182045-105182067 CCATCTGCCTTGTAAAGATTAGA No data
Right 935627348 2:105182091-105182113 TATTTTTGTGGGTATATAGTAGG No data
935627344_935627346 11 Left 935627344 2:105182045-105182067 CCATCTGCCTTGTAAAGATTAGA No data
Right 935627346 2:105182079-105182101 GTTTTAAATATTTATTTTTGTGG No data
935627344_935627347 12 Left 935627344 2:105182045-105182067 CCATCTGCCTTGTAAAGATTAGA No data
Right 935627347 2:105182080-105182102 TTTTAAATATTTATTTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935627344 Original CRISPR TCTAATCTTTACAAGGCAGA TGG (reversed) Intergenic
No off target data available for this crispr