ID: 935628074

View in Genome Browser
Species Human (GRCh38)
Location 2:105187513-105187535
Sequence CTGCAGGCTGAAATGAAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935628071_935628074 10 Left 935628071 2:105187480-105187502 CCACTGAATTTGAAGAAAGGGCT No data
Right 935628074 2:105187513-105187535 CTGCAGGCTGAAATGAAGCCGGG No data
935628068_935628074 25 Left 935628068 2:105187465-105187487 CCTAACTGGAGTCTACCACTGAA No data
Right 935628074 2:105187513-105187535 CTGCAGGCTGAAATGAAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935628074 Original CRISPR CTGCAGGCTGAAATGAAGCC GGG Intergenic
No off target data available for this crispr