ID: 935632458

View in Genome Browser
Species Human (GRCh38)
Location 2:105223402-105223424
Sequence CACCCGGCTGTGGTTTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935632458_935632467 3 Left 935632458 2:105223402-105223424 CCCATGGAAACCACAGCCGGGTG No data
Right 935632467 2:105223428-105223450 GGGTGAACACATTCCTGGCAGGG No data
935632458_935632465 -2 Left 935632458 2:105223402-105223424 CCCATGGAAACCACAGCCGGGTG No data
Right 935632465 2:105223423-105223445 TGGCAGGGTGAACACATTCCTGG No data
935632458_935632466 2 Left 935632458 2:105223402-105223424 CCCATGGAAACCACAGCCGGGTG No data
Right 935632466 2:105223427-105223449 AGGGTGAACACATTCCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935632458 Original CRISPR CACCCGGCTGTGGTTTCCAT GGG (reversed) Intergenic
No off target data available for this crispr