ID: 935640065 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:105281852-105281874 |
Sequence | GGAGACAATTTTATCATGAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 243 | |||
Summary | {0: 1, 1: 0, 2: 4, 3: 17, 4: 221} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
935640062_935640065 | 1 | Left | 935640062 | 2:105281828-105281850 | CCTGGGGAACATGTGGCAATGCC | 0: 1 1: 2 2: 19 3: 142 4: 756 |
||
Right | 935640065 | 2:105281852-105281874 | GGAGACAATTTTATCATGACTGG | 0: 1 1: 0 2: 4 3: 17 4: 221 |
||||
935640061_935640065 | 2 | Left | 935640061 | 2:105281827-105281849 | CCCTGGGGAACATGTGGCAATGC | 0: 1 1: 2 2: 8 3: 62 4: 355 |
||
Right | 935640065 | 2:105281852-105281874 | GGAGACAATTTTATCATGACTGG | 0: 1 1: 0 2: 4 3: 17 4: 221 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
935640065 | Original CRISPR | GGAGACAATTTTATCATGAC TGG | Intronic | ||