ID: 935640073

View in Genome Browser
Species Human (GRCh38)
Location 2:105281881-105281903
Sequence GGTGTGCTATGGCATCTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 6, 3: 18, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935640062_935640073 30 Left 935640062 2:105281828-105281850 CCTGGGGAACATGTGGCAATGCC 0: 1
1: 2
2: 19
3: 142
4: 756
Right 935640073 2:105281881-105281903 GGTGTGCTATGGCATCTAGTAGG 0: 1
1: 0
2: 6
3: 18
4: 107
935640064_935640073 9 Left 935640064 2:105281849-105281871 CCTGGAGACAATTTTATCATGAC 0: 1
1: 0
2: 0
3: 14
4: 138
Right 935640073 2:105281881-105281903 GGTGTGCTATGGCATCTAGTAGG 0: 1
1: 0
2: 6
3: 18
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935640073 Original CRISPR GGTGTGCTATGGCATCTAGT AGG Intronic
903508422 1:23854747-23854769 GGGGTGGTATGCCATCTAGTGGG + Intronic
903664722 1:24999250-24999272 GGCGTGCAATGGCACCTGGTGGG + Intergenic
904994211 1:34618301-34618323 GGGTTGCACTGGCATCTAGTGGG + Intergenic
907596090 1:55721274-55721296 GGAGTGCTATGGCATCTGGTGGG + Intergenic
910033182 1:82756993-82757015 AGAGTGCTATGGCATCTAGACGG + Intergenic
913188011 1:116387766-116387788 GCTGTGCTCTGCCATCCAGTGGG - Intronic
914708053 1:150187688-150187710 GGAGTGCTACTGCATCAAGTGGG - Intergenic
916664046 1:166949199-166949221 GGGATGCTGTGGCATCTAGTGGG - Intronic
918235317 1:182574635-182574657 AGCATGCTATGGCATTTAGTGGG - Exonic
922177865 1:223211134-223211156 GGGGTACTATTGCATCTTGTGGG - Intergenic
922729778 1:227943529-227943551 GGTGTGGAATGGCACCTTGTGGG - Intronic
924772237 1:247088342-247088364 TGGCTGCTATGGCATCTGGTGGG - Intergenic
1064097857 10:12437065-12437087 CGTGTGAAATGGCATCTACTAGG + Intronic
1064831733 10:19476215-19476237 GGTGTGGACAGGCATCTAGTGGG - Intronic
1068011729 10:51460117-51460139 GGGGTCCTCTGGCATTTAGTGGG - Intronic
1068255747 10:54508484-54508506 GTTATGCTATGACATTTAGTAGG - Intronic
1069268641 10:66495074-66495096 GGTGTGCAATGGCAAATATTTGG - Intronic
1070287702 10:75095656-75095678 GGAGTACTATGGCATCGAGGCGG - Exonic
1072663335 10:97376689-97376711 TGGGTGCTCTGGCATCTAGTGGG - Intronic
1074729861 10:116359553-116359575 AGGGTGCTACTGCATCTAGTGGG - Intronic
1075638937 10:124050526-124050548 GGGGTGCTATGGCATCCAGTGGG - Intronic
1075653850 10:124148133-124148155 AGGATGCTATGGCATCTAGGAGG - Intergenic
1082048575 11:47751470-47751492 GGAGTGCTACTGTATCTAGTGGG - Intronic
1084408636 11:68993250-68993272 GGTGGGCTCTGGCATCAAGCTGG + Intergenic
1084609106 11:70190283-70190305 GGTGTGCTATGGCATGATCTCGG - Intergenic
1084998888 11:73011144-73011166 TGTGTGCTCTGGCATGGAGTAGG + Intronic
1087749272 11:101989383-101989405 GAAGTGCTGTGGCATCTAGTGGG - Intronic
1088979903 11:114852880-114852902 AGGATGCTATTGCATCTAGTGGG - Intergenic
1090093444 11:123720941-123720963 GGAGTGCAATGGCATCATGTTGG - Intergenic
1090179725 11:124685703-124685725 GGTGTGCTGAGGCAACAAGTGGG - Intronic
1091437255 12:482241-482263 GGTGTGCTGTGGCTGCTAGTAGG - Intronic
1095052507 12:37567140-37567162 AGTGGGCTCTGGCATTTAGTTGG - Intergenic
1098103132 12:67040241-67040263 GGTGAGCTCTGGCATCGTGTGGG + Intergenic
1098349096 12:69538938-69538960 GGGGTGTCATGGCATCTAGGAGG - Intronic
1099979436 12:89581667-89581689 GGTATGCTATGGGATCTTTTAGG + Intergenic
1103173145 12:118839377-118839399 GAAGGGCTCTGGCATCTAGTAGG - Intergenic
1104576537 12:129971862-129971884 GAGGTGCTATGGCACCTAGTGGG - Intergenic
1104582537 12:130021735-130021757 AGGTTGCTATGGCATCTAATGGG + Intergenic
1115721964 14:36171947-36171969 GCTTTGCTATTGCTTCTAGTTGG - Intergenic
1117666049 14:58057005-58057027 GTTGTGCTCTGCCACCTAGTAGG - Intronic
1119984687 14:79123990-79124012 GGTGTGATATGGGATGGAGTGGG - Intronic
1120257184 14:82135297-82135319 AGTGTGGTATACCATCTAGTGGG + Intergenic
1125312334 15:38393659-38393681 GGTGTGGAATGTCATATAGTTGG - Intergenic
1125672318 15:41483033-41483055 TGTGTGCATTGGCATCTCGTGGG - Exonic
1127937586 15:63657220-63657242 GGTGTGCAATGGTATCTCATTGG + Intronic
1128222116 15:65976745-65976767 GGACTGCTGTGGCATCTAGAAGG + Intronic
1128570181 15:68728049-68728071 GGGTTGCTATGGCATCTGATTGG - Intergenic
1129913232 15:79245297-79245319 GTTCTGCTCTGGCCTCTAGTAGG - Intergenic
1130366976 15:83249482-83249504 GGGGTGCTATGGCATTTAGTGGG + Intergenic
1131267378 15:90924894-90924916 GGTGTGCTTGCGCCTCTAGTTGG - Intergenic
1132646762 16:1002798-1002820 GGGGTGCTGTGGCATCCAGCGGG - Intergenic
1134083682 16:11341936-11341958 AGGGTGCCATGGCATCTCGTGGG + Intronic
1143308058 17:5963933-5963955 GGTGTGTAATGGTATCTAATAGG + Intronic
1145373012 17:22323011-22323033 AGTGGGCTCTGGCATTTAGTTGG - Intergenic
1148221890 17:45868839-45868861 GAGGTGCTATAGCATCTAGTGGG + Intergenic
1150880431 17:69019535-69019557 TGTGAACTATGGCATTTAGTAGG - Intronic
1154405578 18:14087001-14087023 GATGTGCAATGGGATTTAGTTGG - Intronic
1164029327 19:21387237-21387259 GGTGTGCAATGGCATGATGTCGG + Intergenic
1165570610 19:36771955-36771977 AGTGGGCTCTGGCATTTAGTTGG + Intronic
927507112 2:23621776-23621798 TGTGTGCACTGGCATCAAGTGGG + Intronic
927666875 2:25039021-25039043 GGTGTGCAAGCCCATCTAGTGGG + Intergenic
928487477 2:31747326-31747348 GGTATGTCATGGCATATAGTGGG - Intergenic
931366450 2:61623263-61623285 GGTGTGCTATGGCACCATCTCGG - Intergenic
931901304 2:66791396-66791418 AGTGTGCTATGGGATTTTGTAGG + Intergenic
934147343 2:89108524-89108546 GGAGTGCAATGGCATCATGTCGG + Intergenic
934221928 2:90092068-90092090 GGAGTGCAATGGCATCATGTCGG - Intergenic
935640073 2:105281881-105281903 GGTGTGCTATGGCATCTAGTAGG + Intronic
938950619 2:136251289-136251311 AGTGTGTTATGGCATCTTGAGGG - Intergenic
946862691 2:224015023-224015045 GTGGTGCCATGGCATCTGGTAGG + Intronic
947130222 2:226915101-226915123 TGTGTGGTATCACATCTAGTAGG - Intronic
1171547058 20:26010633-26010655 AGTGGGCTCTGGCATTTAGTTGG - Intergenic
1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG + Intronic
1175745849 20:61456453-61456475 AGTGTGAACTGGCATCTAGTTGG + Intronic
1176725630 21:10430197-10430219 GGTGTGCTACTATATCTAGTGGG - Intergenic
1183258900 22:36781543-36781565 AGCTTGCTCTGGCATCTAGTGGG - Intergenic
1183523295 22:38309087-38309109 GGGGTGCCCTGGCATCTAGTGGG - Intronic
949905611 3:8856060-8856082 GCTGTGCTGTTGCATCTAGTGGG + Intronic
951067534 3:18284555-18284577 GGTGTTCCATGGCATATGGTAGG - Intronic
952952449 3:38536150-38536172 GGTGTGTTATTGCTTCCAGTTGG + Intronic
955443595 3:58983212-58983234 GGAGTGCTATGGCAACTGGGTGG + Intronic
974911921 4:68132965-68132987 TGTGTGCTCTGGCATGTAGCAGG - Intergenic
977101789 4:92825395-92825417 GTTGTGCTATGGCACCGAGGAGG + Intronic
977564081 4:98563850-98563872 AGGGTGCACTGGCATCTAGTGGG + Intronic
980842510 4:138281875-138281897 GATTTGCCTTGGCATCTAGTAGG - Intergenic
983047725 4:163006810-163006832 TCTGTGCTATGTCCTCTAGTTGG + Intergenic
991214329 5:64144797-64144819 TCTGTCCTATGGCTTCTAGTTGG - Intergenic
991693479 5:69248436-69248458 GGAGTGCAATGGCATGTCGTTGG + Intronic
996296350 5:121921937-121921959 GGTGTGAGATGGCATCTCATTGG - Intergenic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1003617618 6:7669862-7669884 AGTGTGCTACGGCGTCTAGTGGG - Intergenic
1007237059 6:40398205-40398227 GGTGTGTTCTGGCATCTGGTGGG - Intronic
1007237298 6:40399982-40400004 TGTGTGCAATGGGATCAAGTTGG - Intronic
1007688079 6:43679220-43679242 GGAGTGCTACTGCATCTAGCAGG + Intronic
1008355538 6:50548210-50548232 GATGTGCCATGGCATCAAGAAGG - Intergenic
1009546300 6:65024005-65024027 AGAGGGCTATGGCATGTAGTAGG - Intronic
1010166209 6:72917984-72918006 GGGGTGCTATTGCGTCTAGTGGG - Intronic
1011264668 6:85502787-85502809 GTTGTGCTATGACATTTAGTTGG + Intergenic
1013238077 6:108216329-108216351 GGGGTGCTATGTTGTCTAGTGGG - Intronic
1018812356 6:167307206-167307228 GGTGTGGTCTGGCATCATGTTGG - Intronic
1019741272 7:2675705-2675727 GGTTTGCTGTGGCCTCCAGTGGG - Intergenic
1021917973 7:25454841-25454863 TGAGTGTTATGGCATCTAGTGGG - Intergenic
1025944856 7:66097951-66097973 GGTGTGCAATGGCATGATGTTGG - Intronic
1026885944 7:73945348-73945370 GGAATGCTATGTCATCTGGTAGG + Intergenic
1030465152 7:109891937-109891959 AGTGGGCTATACCATCTAGTAGG - Intergenic
1033427411 7:141256652-141256674 GGTCTGCTCTGGCCTCTAGGTGG + Intronic
1034002601 7:147432248-147432270 GGGGTGCTATGCCATCTAGTGGG - Intronic
1034011526 7:147534189-147534211 GGGTTGCTATGGTATCTAATGGG + Intronic
1044963521 8:97554187-97554209 AGGGTGCCATGGCATGTAGTGGG - Intergenic
1050827453 9:9966414-9966436 CGTGTGCTATGGCAGCAAGGAGG + Intronic
1052455494 9:28691827-28691849 GCTATGCTTTGGCATATAGTAGG - Intergenic
1053797747 9:41741541-41741563 AGTGGGCTCTGGCATTTAGTTGG + Intergenic
1054147441 9:61573416-61573438 AGTGGGCTCTGGCATTTAGTTGG - Intergenic
1054186160 9:61953594-61953616 AGTGGGCTCTGGCATTTAGTTGG + Intergenic
1054467188 9:65504454-65504476 AGTGGGCTCTGGCATTTAGTTGG - Intergenic
1054652343 9:67634929-67634951 AGTGGGCTCTGGCATTTAGTTGG - Intergenic
1056254000 9:84779601-84779623 GGTGTGCTATGTCATGCCGTAGG + Intronic
1059584736 9:115593756-115593778 GGTTTGCTTTGGCATCTACCCGG + Intergenic
1061898489 9:133660822-133660844 GGTGTGCTCTGGGACCCAGTCGG - Intergenic
1062694210 9:137864852-137864874 GGAGTGCTATGGCACTTAGTGGG + Intronic
1186323399 X:8453404-8453426 GGGGTGGATTGGCATCTAGTGGG - Intergenic
1186431626 X:9510132-9510154 GGGGTGCTATGGCATTGGGTGGG + Intronic
1186525276 X:10242597-10242619 GGGGTGCGATGGCATCTAGTGGG - Intergenic
1186744532 X:12553642-12553664 GGTGTTTTATGCCATCTAGCAGG - Intronic
1187457751 X:19457853-19457875 GGTGTGCTGTGGCTTCCAGTGGG - Intronic
1187676484 X:21721350-21721372 GGTGAGCCATGGCTTCTATTTGG - Intronic
1189170675 X:38906408-38906430 GCTGTGCTCAGGCATCTCGTTGG - Intergenic
1192572368 X:72216998-72217020 GATGTGCTTTGGCATCTAGAGGG - Intronic
1193502773 X:82300024-82300046 AGTGTTCTATGGAATCTATTAGG - Intergenic
1193839586 X:86392953-86392975 GTGGTGCTATGGCATCTAGTGGG + Intronic
1195996610 X:110737944-110737966 AGGGTACTCTGGCATCTAGTGGG + Intronic
1196125140 X:112089607-112089629 GGTGTGGTATGGCATAAAGGTGG - Intergenic
1198169171 X:134088898-134088920 GGTGTGAGATGGCATCTTATTGG - Intergenic