ID: 935644487

View in Genome Browser
Species Human (GRCh38)
Location 2:105322976-105322998
Sequence GATGCTGGTGCCATATAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935644483_935644487 -6 Left 935644483 2:105322959-105322981 CCCAATCAACCAGTCAGGATGCT 0: 1
1: 0
2: 2
3: 9
4: 120
Right 935644487 2:105322976-105322998 GATGCTGGTGCCATATAATTAGG 0: 1
1: 0
2: 0
3: 11
4: 156
935644484_935644487 -7 Left 935644484 2:105322960-105322982 CCAATCAACCAGTCAGGATGCTG 0: 1
1: 0
2: 0
3: 5
4: 123
Right 935644487 2:105322976-105322998 GATGCTGGTGCCATATAATTAGG 0: 1
1: 0
2: 0
3: 11
4: 156
935644481_935644487 6 Left 935644481 2:105322947-105322969 CCGTTCACAGCTCCCAATCAACC 0: 1
1: 0
2: 0
3: 10
4: 223
Right 935644487 2:105322976-105322998 GATGCTGGTGCCATATAATTAGG 0: 1
1: 0
2: 0
3: 11
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935644487 Original CRISPR GATGCTGGTGCCATATAATT AGG Intronic
901881769 1:12198318-12198340 GATTCTTGGGCCATATAATGGGG - Intronic
906800680 1:48734391-48734413 GATGCTGCTGCCATAGACTAAGG - Intronic
907823204 1:57990726-57990748 TATGCTGGTCCCATATAATCAGG + Intronic
907990061 1:59572176-59572198 GAGCCAAGTGCCATATAATTTGG + Intronic
910867635 1:91802801-91802823 GAGGCTGGTGCCATTTACTTAGG - Intronic
913561819 1:120028822-120028844 GATGCTGGAGAAATAAAATTTGG - Intronic
913636307 1:120764772-120764794 GATGCTGGAGAAATAAAATTTGG + Intergenic
914282403 1:146188219-146188241 GATGCTGGAGAAATAAAATTTGG - Intronic
914543431 1:148638934-148638956 GATGCTGGAGAAATAAAATTTGG - Intronic
914623191 1:149432074-149432096 GATGCTGGAGAAATAAAATTTGG + Intergenic
917827490 1:178838511-178838533 GATGATGGTGACATATAGATGGG - Intronic
917945732 1:179968714-179968736 AAGGCTGGTGCCATCTAAGTGGG - Intronic
918159385 1:181883201-181883223 GATGTTGGTGACCTATAAATGGG - Intergenic
918513116 1:185333202-185333224 GATGCTGCTGTCAGATAAGTGGG + Intergenic
918597628 1:186310189-186310211 CATGCTGGTGTCATTTCATTTGG - Intronic
921881362 1:220258225-220258247 GATGCTGGTCTCATAGAATGAGG - Intronic
923784672 1:237055455-237055477 GGAGCTGGTGCAAGATAATTCGG + Intronic
1067547054 10:47199996-47200018 GATGCTGATGTCATGTAATCAGG + Intergenic
1067707028 10:48614025-48614047 GATGCTGGTGCCATGCTCTTGGG + Intronic
1068820617 10:61373826-61373848 GATGCTGGTCTCATAGAATGAGG + Intergenic
1071553313 10:86584062-86584084 GATGCTGGTGACAGGTGATTGGG - Intergenic
1072883480 10:99251480-99251502 GATGCTGGCTCCATAGAATTAGG - Intergenic
1081086885 11:38812171-38812193 GATGATGGTGACATACAAATGGG - Intergenic
1088700269 11:112405258-112405280 GATGCTGCTGCCATTTAGTGAGG + Intergenic
1092772511 12:11910140-11910162 GATGCTGGTGACATACAGATAGG - Intergenic
1093567247 12:20622213-20622235 GAGGCTGGTGACATAAAAATTGG - Intronic
1094311915 12:29093341-29093363 GATGCTGGTGACCTACAGTTGGG - Intergenic
1094360744 12:29628511-29628533 AATGCTGGTGGGATATAATGAGG - Intronic
1095103855 12:38208197-38208219 GATGATGGTGACATACAAATGGG - Intergenic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1096841407 12:54381758-54381780 GGAGCAGGTGACATATAATTTGG - Intronic
1098462791 12:70751332-70751354 GATGCTGGTGGCATAGAACAGGG - Intronic
1099641130 12:85286299-85286321 CCTGCTGCTGCCATATATTTAGG + Intronic
1100439719 12:94605480-94605502 GATGCTGGGATCATGTAATTTGG + Intronic
1101009363 12:100433052-100433074 GATGCTTAAGCCAAATAATTAGG - Intergenic
1101196963 12:102393605-102393627 GGTGCTGGTCCTAGATAATTTGG - Intergenic
1104102206 12:125623494-125623516 TATGCTGGTGCCATCTAATAGGG + Intronic
1105420110 13:20244256-20244278 GATGATGGTGCCATACAGATGGG - Intergenic
1108111301 13:47076274-47076296 GATGCTGGCCCCATAGAGTTAGG - Intergenic
1111044172 13:82793733-82793755 GATGCTGTTGTTATGTAATTTGG + Intergenic
1111432802 13:88164949-88164971 GATGCTGGTGCCATGTTCTTGGG - Intergenic
1113457044 13:110456762-110456784 GATGCTGGTGCCTCACAACTGGG + Intronic
1115123056 14:29960546-29960568 GATGATGGTGCCATACAGATGGG + Intronic
1119100699 14:71877834-71877856 GATGATGGTGACATACAAATGGG + Intergenic
1125041511 15:35192572-35192594 CAGGATGGAGCCATATAATTTGG + Intergenic
1126074184 15:44893034-44893056 GATGCTGGCCTCATAAAATTAGG + Intergenic
1133717184 16:8461044-8461066 TATGCTGCTGCCATATTTTTTGG - Intergenic
1146732242 17:35203961-35203983 GATGATGGTGACATATAGATGGG + Intergenic
1146785454 17:35716775-35716797 GATGCTGGTTCCAGATCAATGGG - Intronic
1147746520 17:42698093-42698115 GCTGAAGGTGCCATATAACTGGG + Intronic
1149840387 17:59959212-59959234 GATGGTGGTGTCATTTCATTGGG - Intronic
1150189753 17:63225604-63225626 GATGGTGGTACCATCTACTTAGG - Intronic
1151433900 17:74082360-74082382 GATGCTGCAGCCATCTGATTGGG - Intergenic
1154320578 18:13348222-13348244 GATGATGGTGACATACAAATGGG + Intronic
1154397600 18:14005959-14005981 GATGATGGTGACATATAGATGGG + Intergenic
1156967577 18:43113844-43113866 GCTGCTGGTGGCATTTAATGTGG + Intronic
1157310968 18:46552902-46552924 GATGCAGGTGGCACAGAATTGGG - Intronic
1163446825 19:17351839-17351861 GATGTTGGTGCCATATCTATAGG + Exonic
927494551 2:23543841-23543863 GATGCTGGTGCATTATGAATAGG + Intronic
930130974 2:47850219-47850241 GATGGTGGTGCCATGTACTAAGG + Intronic
930276051 2:49312414-49312436 GATGATGGTGACATATAGATGGG - Intergenic
935644487 2:105322976-105322998 GATGCTGGTGCCATATAATTAGG + Intronic
936058949 2:109282047-109282069 GATGCTGGTGGGATATGAGTGGG + Intronic
937687667 2:124716274-124716296 GATGATGGTGCCACACATTTAGG - Intronic
938579198 2:132631010-132631032 GATGCTGGTGACATCGATTTGGG + Intronic
938862293 2:135381834-135381856 GATGATGGTGCCATGTAGATGGG - Intronic
940572820 2:155462315-155462337 AATGCTGGCCTCATATAATTAGG + Intergenic
940834564 2:158506476-158506498 TATGTTGCTACCATATAATTTGG + Intronic
943710887 2:191093573-191093595 GATGCTGGTGACCTATAGATGGG - Intronic
1171050573 20:21854395-21854417 GATGCTGGTGACCTACACTTGGG - Intergenic
1171430331 20:25079365-25079387 GATGCAGGTGCCATAAACCTTGG + Intronic
1174657483 20:52183546-52183568 GGTCCTGGTGCAAAATAATTAGG + Intronic
1179257495 21:39729422-39729444 GATGCGGTTGCCATAGAATCGGG + Intergenic
1180414723 22:12698229-12698251 GATGATGGTGACATATAGATGGG - Intergenic
1180743687 22:18072216-18072238 GATCCTGGTGCCATCTAGCTTGG - Intergenic
1183039591 22:35166645-35166667 GATGATGGTGACGTACAATTGGG - Intergenic
952560662 3:34589548-34589570 GATGCTGGCCCCATAGAATGAGG + Intergenic
957668023 3:83261936-83261958 GATGATGGTGCAAAATAATCAGG + Intergenic
960226163 3:115171835-115171857 GATTTTGGTGACAAATAATTGGG - Intergenic
961442350 3:126960540-126960562 GCTGCTGCTGCAATGTAATTAGG - Intergenic
963889014 3:150612459-150612481 GATTTTGGTGTCATGTAATTTGG + Intronic
966339007 3:178903916-178903938 GATGCTGGTGCCATTCCCTTGGG + Intergenic
967569799 3:191015596-191015618 GATGATGGTGACATATAGATGGG + Intergenic
967573260 3:191057259-191057281 GAAGCTTGTGCCATTTATTTTGG + Intergenic
968332876 3:197886543-197886565 ATTTCTGGTGGCATATAATTTGG - Intronic
970155956 4:13141973-13141995 CATGCTGGTACCATAATATTGGG + Intergenic
971601152 4:28593668-28593690 GATGCTGGTGCAATATATATTGG + Intergenic
972268267 4:37483709-37483731 AATGCTGGTTTCATATCATTAGG - Intronic
972892843 4:43580799-43580821 TATGCCAGTGCCATATTATTGGG - Intergenic
973555347 4:52076619-52076641 GATGCTGGAGTCAGATAATAGGG + Intronic
974170268 4:58257985-58258007 CATGCCAGTACCATATAATTGGG - Intergenic
974313006 4:60237087-60237109 GAAGATGGTGTCAAATAATTAGG - Intergenic
975975226 4:80087926-80087948 GATGCTGGTGCCATATTTCTTGG - Intronic
976672693 4:87671810-87671832 GATGCTGGTTTCATAGAATGAGG - Intergenic
977861578 4:101967349-101967371 GATTCTGGAGCCATAAACTTGGG - Intronic
985131809 4:186746042-186746064 GATTCTGGTTCCAAATAATATGG + Intergenic
985193902 4:187407585-187407607 GATGTTGGTGACATACAGTTGGG + Intergenic
985844863 5:2336563-2336585 GCTGCTGGTGCCAAATCAGTTGG - Intergenic
986704948 5:10447204-10447226 GATGCTGAAGCCACATCATTTGG - Intronic
986957261 5:13168224-13168246 AATGCTGCTGCAATATAAATGGG + Intergenic
987078043 5:14402750-14402772 GATGGTGGTGGCATAGACTTTGG + Intronic
987279411 5:16397467-16397489 GATGCTGGTCTCATAAAATGAGG + Intergenic
988467216 5:31502259-31502281 GCTGCTGGGGCCATATGTTTCGG + Intronic
990119018 5:52425832-52425854 GTTGCTGGTGCCAAAGAGTTTGG + Intergenic
990221363 5:53593047-53593069 AATGCTGGTCCCATAGAATGAGG + Intronic
991909131 5:71544088-71544110 GATGCTAGTACCATAAAATGAGG + Intronic
992846929 5:80759744-80759766 GAGGCTGTTTCAATATAATTTGG + Intronic
993134670 5:83944086-83944108 TAGGCTGGAGTCATATAATTAGG - Intronic
994371916 5:98977273-98977295 GATTATGGTGCCATATAAACAGG + Intergenic
995591184 5:113701328-113701350 GAGGGTGGTGCCATTTACTTAGG - Intergenic
997664994 5:135623499-135623521 GGTGTTGGAGCCATATAAATTGG + Intergenic
998816141 5:146016123-146016145 GGTGGTGGTGACATATACTTAGG + Intronic
999223302 5:149999608-149999630 GATGATGGTGCCATTTACTGAGG + Intronic
1000589009 5:163135679-163135701 GATGCTCGTTACATATATTTTGG - Intergenic
1000903204 5:166933373-166933395 AATGCTGGCGCGATATAATGAGG + Intergenic
1004854229 6:19733115-19733137 GAGGCTGGTTTCATATATTTTGG - Intergenic
1007014101 6:38445796-38445818 GATACTGTTACCATATAATCTGG + Intronic
1007048957 6:38806344-38806366 GATGATATTGCCAGATAATTGGG + Intronic
1007546641 6:42699395-42699417 GATGCTGGTAAAAAATAATTTGG + Intronic
1008509338 6:52261572-52261594 GATGCTTGTGAAACATAATTGGG - Intergenic
1009656668 6:66555447-66555469 GATGTTGGATTCATATAATTAGG + Intergenic
1010102396 6:72125136-72125158 GATGATGGTGACATATAGATGGG + Intronic
1012339476 6:98102048-98102070 GATGCTGGCCTCATATAATGAGG + Intergenic
1012828637 6:104179347-104179369 GTTTCTGGTGCCAGAAAATTAGG - Intergenic
1017976833 6:159365617-159365639 GATGCTAGTGCCATGTTCTTGGG + Intergenic
1020980070 7:15055840-15055862 GATGATGCTTTCATATAATTTGG + Intergenic
1022491516 7:30823977-30823999 GATTCTTGTGCCATATAAATGGG + Intronic
1023634695 7:42197968-42197990 GATGCTTGGGCCATTTATTTGGG - Intronic
1024016088 7:45316258-45316280 GATGCTGGTGACATACAGATGGG - Intergenic
1030062638 7:105635149-105635171 GAAGCTGGTGCCACAAAATCTGG - Intronic
1035749530 8:1986297-1986319 GATGCAGGTGCAGTAGAATTGGG + Intronic
1039389646 8:37167705-37167727 GATTCTGGAGCCATATGGTTTGG - Intergenic
1041481756 8:58329777-58329799 AATGCTGGTGCCAAGTATTTTGG + Intergenic
1042111273 8:65383585-65383607 GATGCTGGTCTCATAAAATGAGG - Intergenic
1043202724 8:77390993-77391015 GATGCTGGTGCCATTCTCTTGGG + Intergenic
1044027702 8:87194487-87194509 AATACTGGTGACATATTATTAGG - Intronic
1044608622 8:94070122-94070144 GATGCTGGTGCCATGTTCTTGGG - Intergenic
1044617019 8:94152741-94152763 GATGCTGGTGCCATGTTCTTAGG - Intronic
1046525444 8:115377085-115377107 GATGCTGATGCCATTTAGTGAGG + Intergenic
1046578417 8:116061360-116061382 GATGGTGGTTCCATTTAATTAGG - Intergenic
1047304669 8:123643083-123643105 GATGCTGGTGCCATGTTTCTTGG - Intergenic
1047445330 8:124914085-124914107 GATTCTGAGGCCATAGAATTTGG - Intergenic
1049235336 8:141509535-141509557 GATCCTGGTGCCATTTCCTTTGG - Intergenic
1050370816 9:4920193-4920215 GATGATGGTGACATATAGATGGG + Intergenic
1051781149 9:20690244-20690266 GATGCTGGAGCCAAATCCTTCGG - Intronic
1052640410 9:31160098-31160120 GATGATGGTGACATACAGTTGGG + Intergenic
1054853107 9:69869152-69869174 GATACTGGTTCCATTTCATTTGG - Intronic
1058487420 9:105456032-105456054 GATGCTGATGCCCTCTGATTTGG + Intronic
1059841692 9:118224327-118224349 GATGCTGGTGCCAGCCCATTGGG - Intergenic
1060302387 9:122382778-122382800 GAAGAAGCTGCCATATAATTAGG + Intronic
1186775751 X:12863445-12863467 GATGATGGTGACATATAGATGGG + Intergenic
1186914513 X:14205763-14205785 GATGCTGGTGACATACAGATGGG - Intergenic
1186914545 X:14206057-14206079 GATGCTGGTGACATATAGACGGG + Intergenic
1186937122 X:14463002-14463024 GATGTTGGTGACCTACAATTGGG + Intergenic
1188786839 X:34357029-34357051 GATGCTGAGGCCATACATTTTGG - Intergenic
1189894251 X:45637356-45637378 GATGATGGTTTCATAGAATTAGG - Intergenic
1190094766 X:47469961-47469983 GATATTGGTACCATATTATTTGG + Intronic
1190514467 X:51208155-51208177 GATGCTGGTGCCATAGCTTCCGG + Intergenic
1191076590 X:56460350-56460372 GATGATGGTGACATACAGTTGGG + Intergenic
1191732806 X:64355460-64355482 GAAGTTGTTGCCATATAAATTGG - Intronic
1192566248 X:72166128-72166150 GATGGTGGTGCCATTTATTAGGG - Intergenic
1193720234 X:84977181-84977203 GATGATAGTGCCATGTGATTTGG + Intergenic
1194319873 X:92432202-92432224 GAGAATGGTGCCATATTATTTGG - Intronic
1194341990 X:92716535-92716557 GATGCTGGTGACCTATAGATGGG - Intergenic
1196800768 X:119541284-119541306 GGTGCTGGGGCCCTATCATTTGG - Intronic
1197833508 X:130670759-130670781 GACCCAGGTGACATATAATTTGG + Intronic
1200627998 Y:5545335-5545357 GAGAATGGTGCCATATTATTTGG - Intronic
1200650339 Y:5833228-5833250 GATGCTGGTGACCTATAGATGGG - Intergenic