ID: 935645318

View in Genome Browser
Species Human (GRCh38)
Location 2:105329644-105329666
Sequence CCCAGGCCGCGGGGCGGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 544
Summary {0: 1, 1: 1, 2: 12, 3: 54, 4: 476}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935645318_935645327 -3 Left 935645318 2:105329644-105329666 CCCGCGCCGCCCCGCGGCCTGGG 0: 1
1: 1
2: 12
3: 54
4: 476
Right 935645327 2:105329664-105329686 GGGGCCCCGCCGCCCCGCTCCGG 0: 1
1: 0
2: 2
3: 42
4: 319
935645318_935645331 4 Left 935645318 2:105329644-105329666 CCCGCGCCGCCCCGCGGCCTGGG 0: 1
1: 1
2: 12
3: 54
4: 476
Right 935645331 2:105329671-105329693 CGCCGCCCCGCTCCGGCCCGCGG 0: 1
1: 1
2: 11
3: 88
4: 429
935645318_935645337 12 Left 935645318 2:105329644-105329666 CCCGCGCCGCCCCGCGGCCTGGG 0: 1
1: 1
2: 12
3: 54
4: 476
Right 935645337 2:105329679-105329701 CGCTCCGGCCCGCGGCTCCTGGG 0: 1
1: 0
2: 1
3: 24
4: 181
935645318_935645339 16 Left 935645318 2:105329644-105329666 CCCGCGCCGCCCCGCGGCCTGGG 0: 1
1: 1
2: 12
3: 54
4: 476
Right 935645339 2:105329683-105329705 CCGGCCCGCGGCTCCTGGGCTGG 0: 1
1: 0
2: 10
3: 63
4: 368
935645318_935645336 11 Left 935645318 2:105329644-105329666 CCCGCGCCGCCCCGCGGCCTGGG 0: 1
1: 1
2: 12
3: 54
4: 476
Right 935645336 2:105329678-105329700 CCGCTCCGGCCCGCGGCTCCTGG 0: 1
1: 2
2: 4
3: 52
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935645318 Original CRISPR CCCAGGCCGCGGGGCGGCGC GGG (reversed) Exonic
900092193 1:925339-925361 GGGAGGCTGCGGGGCGGCGCGGG + Intronic
900123479 1:1059383-1059405 TCCAGGCTGGGGGGCGGGGCGGG - Intergenic
900513054 1:3069412-3069434 CCCGGGCCGCGCGGCCGAGCCGG - Intronic
900607869 1:3531802-3531824 GCCGGGCCGCGGGGCGGGGGAGG + Intronic
900956675 1:5890216-5890238 CTCAGGCCACGGGACGGAGCTGG - Intronic
901050717 1:6424700-6424722 CGGAGGCTGCGGGGCGGGGCGGG + Intergenic
901068936 1:6507769-6507791 CCCTGGCCCCGTGCCGGCGCGGG - Intronic
901799858 1:11701727-11701749 CCCGGGCTGCGGGGAGGCGGAGG + Intronic
901875869 1:12166935-12166957 GCCAGGCGGCGGGGCGGGGCGGG - Intergenic
902451455 1:16499233-16499255 CCGAGGCCGAGGGGCCGCACCGG + Intergenic
902509947 1:16961074-16961096 CACTGGCCGCGGGGCTGGGCTGG - Exonic
903233749 1:21936978-21937000 CCCATGCCGCAGGGTGGCGCCGG + Intronic
903339253 1:22643834-22643856 CCCAGGCCCCGGGGCCCAGCAGG - Intronic
903349614 1:22710233-22710255 CCCAGGCACCGGGGCTGGGCCGG - Intergenic
903438319 1:23368946-23368968 GCCCCGGCGCGGGGCGGCGCGGG - Intronic
903724720 1:25431560-25431582 CCCAGGCCACCGGGGGGCTCGGG - Intronic
904034666 1:27552131-27552153 CGCAGGCCGCCGGGCGGGGCCGG + Exonic
904093323 1:27959960-27959982 CGCAGCCCTCGGGGCGGCCCGGG - Exonic
904237683 1:29124922-29124944 CCCCCGACGCGGGGCGGAGCCGG + Intergenic
904631987 1:31849234-31849256 CCCAGGCCGTGGGGCTCCACAGG - Intergenic
905390993 1:37635109-37635131 CCCGGGGCGCGGGGAGGGGCAGG - Intergenic
905548691 1:38818888-38818910 CCCTGGCCGCGGGTCCGGGCTGG + Intergenic
905626222 1:39491933-39491955 CCCGGGCCCAGGGGCGGCGGCGG + Exonic
906650399 1:47508626-47508648 CCCCCGCCGGGGGGCTGCGCTGG + Intergenic
906960914 1:50419091-50419113 CCCAGGCCCCCCGGCGGCGGCGG + Exonic
907285226 1:53375765-53375787 TCCAGGCCTGGGGGTGGCGCTGG + Intergenic
908356677 1:63329741-63329763 CCCAGGCAGCGGGGAGCCCCAGG - Intergenic
908523517 1:64966567-64966589 GGCCGGCCGCGGGGCGGGGCGGG - Intergenic
912269241 1:108192633-108192655 CTCAGGCCGCGGAGCTGCGAGGG - Intronic
912492622 1:110070473-110070495 CGCGGGCCGCGGGGCGGCGCGGG + Exonic
912539959 1:110407415-110407437 CCAAGGCCGCAGGGCGGGGCGGG - Intronic
913109082 1:115641927-115641949 CTCGGGCTGCGGGGCGGCGCCGG + Intergenic
913979633 1:143497649-143497671 CCCTGGCGCCGGGGCGGCGGGGG - Intergenic
914944717 1:152053678-152053700 CCAAGGCCCCGGGGAGGAGCAGG - Intergenic
915326914 1:155085473-155085495 CCTAGGCTCCGGGGCGGGGCCGG + Intronic
916656022 1:166876056-166876078 CACAGGCCCCCGGGCGACGCGGG + Intronic
917817473 1:178725429-178725451 CTCAGGCCGCGGGGCGGTGCGGG + Intronic
918793208 1:188857928-188857950 CCCACGCTGCGGGGAGGCTCGGG - Intergenic
919767373 1:201136050-201136072 CCCAGGCCCCAGGGAGGGGCAGG - Intronic
919809499 1:201399669-201399691 CCCGGGCCGCGGCACAGCGCGGG - Intergenic
919820564 1:201469310-201469332 CGCAGGGCGCGGGGCGGGGAGGG + Intergenic
919822171 1:201480531-201480553 CCCCAGCTGCGGGGCGGGGCGGG + Intergenic
920511750 1:206557085-206557107 CCCAGGCGGCGGGGAGGCGGGGG + Intronic
921472622 1:215567421-215567443 TCCAGGCCGCCGGGCCGCCCGGG - Exonic
922196628 1:223364666-223364688 CCCAGCCCGCGGCGCGGCGCGGG + Intergenic
922287497 1:224183106-224183128 CCCAGGCCCCCGTGCGGGGCCGG - Intronic
922287627 1:224183564-224183586 GCCAGCCCGCGGGTCAGCGCGGG + Intronic
922488882 1:225999458-225999480 GCCGGGCGGCGGGGCGGTGCGGG + Intergenic
922730798 1:227947988-227948010 TCCCGGGCGCGGGGCGGGGCCGG - Intergenic
922744867 1:228038100-228038122 CCGTGGCCGCGGTGGGGCGCGGG + Intronic
923566994 1:235083721-235083743 CCCAGATGGCGGGGCGGGGCTGG + Intergenic
924199034 1:241640441-241640463 GACAGGCCGCGGGGAGGGGCGGG - Intronic
924436748 1:244049083-244049105 CCCGGCCGGCTGGGCGGCGCGGG + Intronic
1063001939 10:1932726-1932748 CCCAGGCAGCAGGGAGGGGCTGG - Intergenic
1063443042 10:6089051-6089073 CTCAGGGCGCTCGGCGGCGCGGG - Intronic
1063965667 10:11344211-11344233 CCCAGGACACGGGGCAGGGCTGG + Intergenic
1064202970 10:13299973-13299995 CCCCGGCCGAGGGGCGGCCGAGG + Exonic
1064208841 10:13347422-13347444 CCCGGGCTGCGGGCCGGCGGCGG + Intronic
1064662211 10:17617426-17617448 CCCAAGGGGCGGGGCGGGGCGGG - Intergenic
1066660915 10:37737601-37737623 CCCATGCAGCGGGGAGGCTCAGG - Intergenic
1067286475 10:44911203-44911225 CTCAGGCGGCTGGGCTGCGCTGG + Exonic
1067474469 10:46556753-46556775 CCCGGGCCGCGGCGGGGCGGTGG - Intergenic
1069588904 10:69630133-69630155 CCCAGGGTTGGGGGCGGCGCGGG - Intergenic
1069738440 10:70672612-70672634 TCCAGGCGGCGGCGCCGCGCAGG + Intergenic
1069856333 10:71443150-71443172 CCCAGGCCTCAGGGCGGTGGTGG - Intronic
1070333042 10:75431532-75431554 ACCGGGCCGAGGGGCGGCGGCGG + Intronic
1071055339 10:81503126-81503148 CCCAGGCGGCGGGGAGGCTCGGG - Intergenic
1071618082 10:87094638-87094660 CCCCGGCTGCGGGGCGGCGGCGG + Exonic
1072638881 10:97196231-97196253 CCGACGCCGCGGGCCGGGGCTGG - Intronic
1074130418 10:110568257-110568279 CCCCGGCCCGGGGGCGGCCCTGG + Intronic
1075334410 10:121598123-121598145 CCCAGGCTGCGGAGGAGCGCGGG + Exonic
1075501731 10:122980716-122980738 CCTGGGCCGCGGGGCGGGGCGGG + Intronic
1075616061 10:123891661-123891683 CCCTGGGCGCGGGGCGGAGCAGG - Exonic
1076064804 10:127440729-127440751 CACAGGCCGCAGAGCAGCGCTGG - Intronic
1076596366 10:131625128-131625150 CGCAGGCCACAGGTCGGCGCAGG + Intergenic
1076639008 10:131901337-131901359 CCCGGGGCGGGGCGCGGCGCGGG - Intronic
1077020888 11:416765-416787 CCCAGGGCGCAGGTGGGCGCGGG - Intronic
1077178133 11:1199772-1199794 CCCAGCCTGCTGGGCGGGGCGGG + Intronic
1077637847 11:3855642-3855664 TCCAGGCGGGCGGGCGGCGCGGG - Intronic
1077886312 11:6390510-6390532 CTCAGGGCCCCGGGCGGCGCCGG - Exonic
1079128983 11:17736620-17736642 CCCTGCCCGCGGGGAGGCACAGG - Intronic
1080418649 11:32091646-32091668 CCCCGGCCGGGGCGCGGCGGCGG - Intronic
1080503651 11:32892777-32892799 GCAAGGCCGCGGGGCGGAGGGGG + Intergenic
1080588328 11:33700493-33700515 CCCAGGCCGGGTGGTGGCGGGGG + Exonic
1081637041 11:44727779-44727801 CCCTGGCAGCGGGGCGGGGCGGG + Intronic
1083609676 11:63998924-63998946 GGCGGGCCGTGGGGCGGCGCGGG + Intronic
1083618164 11:64036378-64036400 GCCCCGCCGCGGGGAGGCGCGGG + Intronic
1083670939 11:64299673-64299695 CCGGGGCCGCGGGGCCGCACGGG - Exonic
1083728884 11:64642749-64642771 CCAGGGCCGGGGGGCGGCGCGGG + Intronic
1083901773 11:65646799-65646821 CCCGGGGCGCGGGTCGCCGCCGG + Exonic
1083949310 11:65945348-65945370 GCCAGGCCGGGGGGCAGCACAGG + Intergenic
1083997228 11:66278430-66278452 CCCGGGCCGCCGCCCGGCGCGGG + Exonic
1084087243 11:66860250-66860272 CCCAGGCCAGGCGGCGGCCCCGG - Exonic
1084401945 11:68949417-68949439 GCCAGGCCGTGGGGCGGCAGGGG - Intergenic
1084962973 11:72726883-72726905 CACAGGCCGTGGGGTGGGGCGGG + Exonic
1085143431 11:74170892-74170914 CCCAGGCTGCCCAGCGGCGCCGG - Exonic
1085474808 11:76783229-76783251 GGCCGGCCGCGGGGCGGCTCAGG - Intronic
1087138110 11:94740504-94740526 CCGAGGGCGCGCGGCGGCGGCGG - Intronic
1088314924 11:108498100-108498122 CCCGGGCGGCGGGGACGCGCGGG + Intronic
1088604086 11:111512425-111512447 CGCGGGCCGAGGGGCGGGGCGGG - Intergenic
1089533793 11:119148983-119149005 CGCGGGCTGCCGGGCGGCGCGGG + Intergenic
1089729461 11:120511527-120511549 CCCAGGCGCGGGGGCGGCGGGGG - Intergenic
1090224817 11:125063521-125063543 CCCTGGCCACGCGGCGACGCCGG - Intronic
1090327779 11:125904188-125904210 GGCGGGCCGCGGGGCGGCGCGGG + Intronic
1091124503 11:133082788-133082810 CCCGGGCCGCGAGGAGGCCCAGG - Intronic
1091225755 11:133955924-133955946 CCCAGGCTGCGAGGCAGAGCTGG - Intronic
1091888093 12:4031311-4031333 CGCCGGGCGCGGGGAGGCGCGGG - Intergenic
1092196750 12:6554515-6554537 GCGAGGCCGCGGGGCGGGCCCGG - Intronic
1092219122 12:6700756-6700778 CCTGGGGCGCGGGGCGGCGGCGG + Intronic
1092743236 12:11649866-11649888 TGCAGGTCGCGGCGCGGCGCGGG - Exonic
1093714449 12:22365963-22365985 CCCAGGGCTCGGGGGGGCGTAGG - Intronic
1094025648 12:25958332-25958354 CTCAGGCCTCGGTGCGTCGCGGG + Intergenic
1094460368 12:30691394-30691416 CCCAGGCCACAGGGCAGAGCAGG - Intronic
1094470280 12:30796239-30796261 CTGCGGCCGCGGGGCGGCGGGGG - Intergenic
1095949354 12:47773445-47773467 CCCGGGACGCTGGGCGGCGCGGG + Intronic
1096626161 12:52897373-52897395 CCCAGGCTCTGGGGCAGCGCAGG + Exonic
1096786225 12:54018640-54018662 CCCAGGCCGGGGAGCAGGGCGGG - Intronic
1097223231 12:57462315-57462337 CCCAGGCTGCCGGGCCGGGCTGG + Intronic
1097293731 12:57941725-57941747 CCCCTGCCGCGGGGCCCCGCCGG - Exonic
1099989561 12:89708562-89708584 CCCCGGCCGCGGGCGGGCGGCGG + Intronic
1101692162 12:107092957-107092979 CCCATGCCGGGGGGCGCGGCGGG + Exonic
1102218353 12:111177779-111177801 CCCAGGCCTCGGGCCAGCCCTGG - Intronic
1103433011 12:120904059-120904081 CCTGGGCCCCGGGGCGGGGCGGG + Exonic
1103604714 12:122078426-122078448 CCCGGGGCGCGGAGCGGGGCGGG + Intergenic
1103623861 12:122204410-122204432 CCCAGGCTGCGCCGCGGCCCGGG - Intronic
1103649687 12:122422783-122422805 AAGAGGCGGCGGGGCGGCGCGGG - Intergenic
1103809431 12:123601911-123601933 CCCAGGGCGCTGTGCGGAGCGGG + Intergenic
1103949639 12:124543776-124543798 CCCAGGCCGGGAGGCCGCGGAGG + Intronic
1104448767 12:128853361-128853383 CCCTGGGTGCGGGGTGGCGCGGG - Intergenic
1104968838 12:132522087-132522109 CCCAGGCTGAGGGGCCGCGCCGG - Intronic
1104980178 12:132570141-132570163 AGCAGGCCGCGGGGCTGCGGGGG - Exonic
1105475063 13:20721771-20721793 CGCAGGCGGGGGTGCGGCGCAGG - Exonic
1105768070 13:23579890-23579912 CGCAGGACGCGGGCGGGCGCCGG - Intronic
1105837274 13:24222934-24222956 CCCAGGCTGCCGTGCGGCCCTGG + Exonic
1106248364 13:27966908-27966930 CGCAGCCCGCGGGCCGGAGCCGG - Intronic
1106248867 13:27969124-27969146 CCCAGCCCGCGGTGCTCCGCTGG + Exonic
1106480479 13:30133612-30133634 CCCCAGCCGCAGGGCCGCGCAGG + Intergenic
1108340743 13:49496219-49496241 CCTAGACGCCGGGGCGGCGCTGG + Intronic
1112507510 13:99983812-99983834 CCCAGGCAGCGCGGCCCCGCGGG + Intronic
1112591277 13:100765211-100765233 TCCAGGCCCAGTGGCGGCGCCGG - Intergenic
1113541792 13:111115190-111115212 CGCAGGGCGCGGGGCGGCGCGGG + Intronic
1113541820 13:111115281-111115303 CCGAGGCCGGGGGGCGGCGGCGG + Exonic
1113874335 13:113585004-113585026 CGCAGGGCGCGGGAGGGCGCGGG - Intronic
1113967701 13:114163775-114163797 CCCAGGCCGAGGGCAGGGGCAGG + Intergenic
1114525536 14:23365338-23365360 CCTAGGCCGCGGGGGCGCCCCGG + Exonic
1115119882 14:29927202-29927224 CCTGCGCCGCGGGGAGGCGCCGG + Intronic
1115689340 14:35826844-35826866 TCCCGGCGGCGGGGCGGGGCGGG + Intronic
1115850048 14:37583956-37583978 CCCTGGGCTCGGGGGGGCGCGGG - Intergenic
1116018352 14:39432557-39432579 CGCAGGCCGCGGGGCGGGGCGGG + Intergenic
1117029292 14:51652077-51652099 CCCTGCCGGCGGGGCGGCGGCGG + Intronic
1117251863 14:53946870-53946892 CCCAGGCCCGGCGGCGGCGGGGG - Intergenic
1117964069 14:61189148-61189170 CCCGGGCCTCGCGGGGGCGCTGG - Intronic
1118030350 14:61812624-61812646 TGCTGGGCGCGGGGCGGCGCGGG + Intergenic
1118285260 14:64465373-64465395 CCGGAGGCGCGGGGCGGCGCGGG - Intronic
1118293742 14:64549910-64549932 CCCGGGGCGCGGAGCGGGGCGGG - Exonic
1119046327 14:71321143-71321165 CCCGGGACGCGCGGCGGCACCGG + Intronic
1119786886 14:77320817-77320839 CCCCGGGCTCGGGGCGGGGCGGG + Exonic
1122418212 14:101560484-101560506 CAGCGGGCGCGGGGCGGCGCCGG - Intergenic
1122799359 14:104221979-104222001 CCCAGGCTGAGGGGCAGCCCTGG + Intergenic
1122809508 14:104281075-104281097 CCCAGGCCGTGGAGACGCGCGGG + Intergenic
1122942029 14:104985785-104985807 GCCAGGCAACGGGGCGGCGCAGG + Exonic
1123000818 14:105293169-105293191 CCCAGGCCGCAGGGAGAGGCTGG + Intronic
1123630801 15:22258321-22258343 CCCGGGGCGCGGCGCGGCGCGGG + Intergenic
1124629418 15:31328097-31328119 TCCCGGCCGGGAGGCGGCGCGGG + Intronic
1124966721 15:34437401-34437423 GCCAGGGCGCGGGGCTGCCCCGG + Intronic
1124983343 15:34583519-34583541 GCCAGGGCGCGGGGCTGCCCCGG + Intronic
1125051196 15:35299554-35299576 CGCGGGGCGCTGGGCGGCGCGGG + Intronic
1126109346 15:45166737-45166759 CCCAGGCCTCTGGGCGGGCCCGG - Intergenic
1127789932 15:62390613-62390635 CCCAGCGCGCGGGGGGACGCGGG + Intronic
1128056495 15:64703291-64703313 CCCAGGACACCGCGCGGCGCTGG - Intergenic
1128160990 15:65422843-65422865 CCCATGGCGCGGGGGGACGCCGG - Exonic
1128322562 15:66703488-66703510 CCCAGGGCGCGGGGAGGCGCCGG + Exonic
1128506798 15:68278261-68278283 CCCAGGCAGCAGTGCGGCCCAGG - Exonic
1129189207 15:73927659-73927681 CCCCGGTCCCGAGGCGGCGCAGG + Exonic
1129382857 15:75178718-75178740 CACAGGCGGCGGGCGGGCGCGGG - Intergenic
1129880509 15:79003586-79003608 CCCAGGCTGCGGGGGGAGGCAGG - Intronic
1130256954 15:82330168-82330190 GCCAGGCTGCGGGGGGGAGCAGG + Intergenic
1130517014 15:84633524-84633546 CCCAGGCTGCGGAGGAGCGCAGG - Intergenic
1130597994 15:85259820-85259842 GCCAGGCTGCGGGGGGGAGCAGG - Intergenic
1131888622 15:96947920-96947942 CCGAGGACGCGGGCCGGCGCGGG - Intergenic
1132029097 15:98426202-98426224 CCCAGGCAGCTGGGAGGCCCTGG - Intergenic
1132203760 15:99972629-99972651 CGCAGGCCGCGGGGCGAGGGTGG + Exonic
1132298400 15:100761397-100761419 CCCAGGCCCCGGGGCTGACCAGG - Intergenic
1132320135 15:100919468-100919490 GCCAGGCCGCCGGGGGGCGCCGG - Intronic
1132498867 16:275962-275984 ACCCGGGCGCGGCGCGGCGCGGG - Intronic
1132508978 16:327410-327432 CACAGGCCGCAGGGCTGAGCCGG - Intronic
1132689697 16:1176972-1176994 CCCAGGCTGGGAGGAGGCGCTGG + Intronic
1132701648 16:1224702-1224724 GCCAGGCCTCAGGGCGGCACTGG + Intronic
1132856642 16:2047989-2048011 CCCTGGCCCCGGGACGCCGCCGG - Exonic
1133073791 16:3264293-3264315 GCCCGGACGCGGGGAGGCGCTGG + Intronic
1133220442 16:4317159-4317181 CCCAGGCCCCAGGGCAGGGCTGG - Intronic
1133973002 16:10580510-10580532 CCCAGGGCGCGGGGCGACATCGG - Intronic
1134279275 16:12803583-12803605 CCCAGGCCCCGGTGCAGCCCCGG + Intronic
1137426328 16:48384702-48384724 CCCGGGCCTCCGGGCGCCGCGGG + Intronic
1138651369 16:58463414-58463436 CACAGTCCGCGCGGCGGAGCGGG + Intronic
1138651425 16:58463594-58463616 CTCGGCCCGCGGGGCGGTGCCGG - Intronic
1138660878 16:58516153-58516175 CCCGGCCCGCGAGGCCGCGCCGG + Intronic
1139974785 16:70800944-70800966 CCCTGGCCCCGGCGCGGCCCCGG - Exonic
1141546984 16:84776751-84776773 CCCAGGTCCCGGGGCGAGGCAGG - Intronic
1141620879 16:85235966-85235988 CCCAGGCCCAGGCCCGGCGCCGG - Intergenic
1141665435 16:85463060-85463082 CGCGGCCCGGGGGGCGGCGCAGG + Intergenic
1141972241 16:87492246-87492268 CCCGGGTCGCGGCGCGGCGCGGG - Intergenic
1142070862 16:88090785-88090807 CCCAGCCCGCGGGGGGTCGGGGG + Intronic
1142130799 16:88430691-88430713 CCCTGGCGGCGGGGAGGCCCCGG + Intronic
1142156445 16:88534675-88534697 CCCGGGCTGCGGGGAGGCGGCGG - Exonic
1142200252 16:88757695-88757717 GCCAGGCTGCGGGCCGGAGCTGG + Intronic
1142376801 16:89710803-89710825 CTGGGGCCGCGGGGCTGCGCTGG + Exonic
1142421447 16:89972840-89972862 CGCCGGCCGCGGGGGAGCGCGGG + Intergenic
1142518622 17:489870-489892 CCCATGCCGGGGGGCAGGGCCGG + Intergenic
1142749192 17:1977524-1977546 CCCAGGCCGGCGGGCGGGGTGGG - Intronic
1143012576 17:3873973-3873995 TCCAGGGCGCGGGGAGGCCCAGG - Intronic
1143544548 17:7588653-7588675 CCCAGCCCGCTGGGCGCAGCAGG + Intronic
1144515947 17:15917664-15917686 CCCAGGCTGCGGCTCCGCGCCGG + Intergenic
1144758642 17:17694816-17694838 GCGGGGCCGCGGGGCGGGGCGGG + Intronic
1145243517 17:21253036-21253058 CCCGGGCGGCGGGCCGGAGCCGG + Intronic
1146229484 17:31095280-31095302 CCGCGGCCGGGGGGCGGCGGAGG - Exonic
1146283515 17:31559755-31559777 CTCAGGCCGAGGGACAGCGCTGG - Intergenic
1146912565 17:36658048-36658070 CCAAGGCCCCGGGCCGGTGCGGG + Intergenic
1147311599 17:39599111-39599133 CCGAGGCTGGGGCGCGGCGCAGG - Intergenic
1147672404 17:42184215-42184237 CCGAGGCAGGGGCGCGGCGCTGG + Exonic
1147757890 17:42780540-42780562 GGCGGGCCGCGGGGCGGCGACGG + Intergenic
1147967120 17:44199495-44199517 CCCCGCCCGGGGGGCCGCGCCGG + Intronic
1148178016 17:45584691-45584713 CCCCGGCCGGGGGGAGGCGGGGG - Intergenic
1148225204 17:45894500-45894522 CTGAGGCCGGCGGGCGGCGCAGG - Exonic
1148554286 17:48568977-48568999 CCCAGCCCGCGGTGTGGCTCCGG + Intronic
1148759695 17:49993361-49993383 CCAGGGCCGCGGGGGCGCGCGGG - Intronic
1148760499 17:49997275-49997297 CACAGTCTGCGGGGCGGGGCAGG - Intergenic
1149678585 17:58488093-58488115 CCCGGGCCGGGGGGCGGTGGCGG - Exonic
1150407904 17:64918977-64918999 CCCCGGCCGGGGGGAGGCGGGGG - Intronic
1151370739 17:73644878-73644900 CGCCAGCCGCGGGGCGGCGGGGG + Intergenic
1151660770 17:75516838-75516860 CTCAGGCCGAGCGGCTGCGCCGG + Exonic
1151875974 17:76868545-76868567 CCATGGGCGCGGCGCGGCGCGGG + Intronic
1152013434 17:77734830-77734852 CCCAGGGGGCGGGGCTGAGCGGG + Intergenic
1152535864 17:80950045-80950067 CCCAGGCCGTGCAGCGGTGCAGG - Intronic
1152544006 17:80991854-80991876 CGGTGGCCGCGGGGCGGCGGTGG + Exonic
1152628516 17:81399389-81399411 GCCAGGCCGGGTGGCGGGGCCGG - Intronic
1152688735 17:81707910-81707932 ACCCGGCCACGGGGCTGCGCAGG + Intergenic
1152748473 17:82051852-82051874 TCCGGGGCGCGGGGCGGGGCGGG - Intronic
1152924174 17:83079924-83079946 GCCGGGCTGCTGGGCGGCGCGGG + Exonic
1153382637 18:4455489-4455511 CCCAGGCCGCGGGGAGGCGCCGG + Intergenic
1153457219 18:5295268-5295290 CCCCGGCCGCGGGAGGGCGGGGG - Intronic
1153973769 18:10248803-10248825 CCCAGGCTGTGGGGCGATGCTGG - Intergenic
1154295211 18:13141420-13141442 GCCAGGCCCCGAGGCGGGGCAGG - Intergenic
1155033216 18:22002097-22002119 CGCAGGGCGCGGGAAGGCGCAGG - Intergenic
1155954093 18:31942839-31942861 GCCAGGCCGGCGGGCGGCGGCGG - Exonic
1156171748 18:34494000-34494022 CCGGGGGCGCGGGGCCGCGCAGG + Intronic
1157464187 18:47930512-47930534 CCCGGGCCTGGGGGCGGGGCGGG - Exonic
1157599637 18:48886042-48886064 CCCAGGCCCCGGGCAGCCGCGGG + Intergenic
1157849027 18:51030419-51030441 CCCCCGCCGCAGGGCGGCCCGGG + Exonic
1158277095 18:55780401-55780423 CCGCGGCCGCGAGGCGGGGCTGG - Intergenic
1158836309 18:61334300-61334322 GCCAGGCTCCGGGGAGGCGCAGG + Intronic
1158954163 18:62523605-62523627 CCGAGTCCCCGGGGCGGCGGCGG - Exonic
1159040283 18:63318412-63318434 CGCAGGCCCCGCGGCGGCGCCGG + Exonic
1160242298 18:77132599-77132621 CCGAGGCCGAGGGGCGCCGCGGG + Exonic
1160242396 18:77132906-77132928 CCGAGCTCCCGGGGCGGCGCCGG - Intronic
1160453446 18:78980162-78980184 CGCGGGGCGCGGGGCGGCGGCGG - Intergenic
1160793949 19:935247-935269 GCCAGGCCGCGGCGGGGGGCCGG + Intronic
1160935419 19:1592427-1592449 CCCAGGCCGCGGCCCGGGGCAGG + Intronic
1160991520 19:1862264-1862286 CGCAGTCCCCGGGGCGGCGAGGG - Intronic
1161265188 19:3360409-3360431 CCCAGGCCCTGGAGCGGCGGTGG + Intronic
1161266359 19:3366520-3366542 CGCCGGCCGCGGGGCGGGGGGGG + Intronic
1161379712 19:3958618-3958640 CCCACGCTGCTGGGTGGCGCCGG - Exonic
1161399573 19:4061375-4061397 CACAGGCCGCTGGGCGGGGAGGG - Intronic
1161764580 19:6199667-6199689 CGCAGGACGCGGGGAGGGGCGGG - Intergenic
1162007549 19:7789682-7789704 GCCGGGCGGTGGGGCGGCGCCGG + Intergenic
1162046848 19:8005644-8005666 TCCGGGCCGCGGGCCGGAGCGGG - Intronic
1162113392 19:8413454-8413476 GCCAGTCCGCGGGCCGGCCCCGG + Intronic
1162131290 19:8527549-8527571 CCCAGGCAGAGGGGTGGTGCTGG + Intronic
1162257035 19:9498824-9498846 CCCATGCCCGGGGGCGGGGCTGG + Intergenic
1162571962 19:11479494-11479516 CAAAGGACGCGCGGCGGCGCGGG + Intronic
1162581873 19:11536225-11536247 CCCGGGCCGCCAGGGGGCGCCGG + Intergenic
1162926559 19:13933162-13933184 CGCAGGCGGCGGGGCAGGGCTGG + Exonic
1163294421 19:16403225-16403247 CCCAGTCCAGGGGGGGGCGCTGG - Intronic
1163843950 19:19628273-19628295 CCCAGGTGGCGGGGCGGGGCAGG - Intronic
1165204522 19:34172460-34172482 CTCAAGCCGCGGCGCGGCGGCGG - Intergenic
1165242901 19:34481846-34481868 CCCTGGGCGCGGGGCGGGGCGGG - Exonic
1165774357 19:38395992-38396014 CCCAGCGCGCGGCGGGGCGCGGG - Exonic
1166366406 19:42280627-42280649 CGCGGGCCGCGGCGGGGCGCCGG - Intronic
1166677601 19:44748998-44749020 GCCAGGCCGTGGGGGGGCCCGGG - Exonic
1167134533 19:47608999-47609021 GCCTGGGCGCGGGGCGGCGGCGG + Intronic
1167391262 19:49196648-49196670 TCCAGGGAGCCGGGCGGCGCCGG - Exonic
1167499278 19:49836298-49836320 CCCAGGCCCTGGTGCGGCGGAGG - Exonic
1167641878 19:50686848-50686870 CCCCGGGGGCGGGGCGGAGCGGG + Intronic
1168151739 19:54452760-54452782 CCCAGCCAGTGGGGCGGGGCAGG + Intronic
1168280244 19:55301862-55301884 TCCAGGCAGCGGGAGGGCGCAGG + Intronic
1168315708 19:55483902-55483924 CCCGGGCCCCGGGGAGGCGGGGG + Exonic
925358950 2:3263713-3263735 CCCAGGACGCGGCACGGTGCCGG + Intronic
925730534 2:6917319-6917341 TCCGGGCCTCGGGCCGGCGCAGG + Intergenic
927053425 2:19350624-19350646 CCCTGACCGCGGGACCGCGCAGG - Intergenic
927125997 2:20012716-20012738 TCGAGGCCCCGGGGCGGGGCGGG - Intergenic
927787129 2:25981941-25981963 CCCAGGCTGCGGAGGGGCTCGGG - Exonic
928093759 2:28392131-28392153 ACCCGGCCGCAGGGCGGCGCGGG + Intergenic
932329145 2:70887819-70887841 ACCAGGGCGAGGGGCGGGGCCGG - Intergenic
932416486 2:71576546-71576568 GCCAGGCCGCAGGGCGGGGTGGG + Intronic
932780084 2:74554230-74554252 GCCGGGCGGCGGGGCGGCCCCGG + Exonic
933655202 2:84881115-84881137 CCGGGGCCGCGGGGCGCCTCCGG + Exonic
934708888 2:96502734-96502756 CCCTGGACGAGGGGCGGTGCCGG + Intronic
935645318 2:105329644-105329666 CCCAGGCCGCGGGGCGGCGCGGG - Exonic
936126693 2:109794573-109794595 ACCCGGCCGGGGGGCGGCGGCGG + Intronic
937097929 2:119247801-119247823 TCCAGGCCGGGAGGAGGCGCAGG - Exonic
937751380 2:125479197-125479219 CCCAGAGCAGGGGGCGGCGCCGG + Intergenic
937904877 2:127048233-127048255 GCCTGGCCGCAGGGCGGGGCTGG - Exonic
938416298 2:131105834-131105856 CCCAGGCGGCGGGCCGCAGCAGG - Intronic
940971992 2:159904838-159904860 CCTCGGCCCCGGGGCGGAGCGGG + Intergenic
941112126 2:161427193-161427215 TCGAGGCCGCGGGGCCGCGGGGG + Intronic
941819216 2:169827853-169827875 ACCAGGCCGCAGAGCGCCGCGGG - Exonic
941911729 2:170770909-170770931 CCCAGGCCGTAGGGCGGTGGAGG - Intergenic
942116758 2:172735816-172735838 CCCAGGCCGCGGGAGCCCGCGGG + Intronic
942292672 2:174487335-174487357 CCCAGCCGGCAGGGCGGGGCCGG - Intergenic
942449443 2:176099971-176099993 CGCAGGCTGCGCGGGGGCGCAGG - Exonic
946250131 2:218406535-218406557 TCCCGGACGCGGGGCGGGGCGGG - Intergenic
948079253 2:235192040-235192062 CCCAGACAGCGGAGGGGCGCCGG - Intergenic
948116032 2:235494628-235494650 CCCGGGGCGCGGGGCGGCGGCGG + Exonic
948207048 2:236168010-236168032 TCCCGGCGGCGGCGCGGCGCGGG - Exonic
949060495 2:241953794-241953816 CCCAGGCCCCAGGGAGGAGCCGG + Intergenic
949060508 2:241953822-241953844 CCCAGGCTGTGGGGAGGAGCCGG + Intergenic
1168802716 20:653422-653444 CCCCGGACGCCGCGCGGCGCAGG - Intronic
1168830224 20:841601-841623 CAGAGGCCGCGGGGCAGGGCTGG - Intronic
1169214734 20:3786518-3786540 CCCCCGCCCCGGGGCGGCGGCGG - Exonic
1169327432 20:4686908-4686930 CGCAGGGCGCGGGGCGGGGAGGG + Intronic
1169367189 20:5001263-5001285 CGCAGGCCGCGCCGCGGGGCCGG + Intronic
1169438074 20:5611032-5611054 GCCACCCCGCGGGGCGGGGCCGG + Intergenic
1170630023 20:18057767-18057789 CCCCCGCCGCGGCGCGGCCCAGG + Exonic
1170969570 20:21104577-21104599 CCCAGGACGCGGGGCAGCTTCGG + Intergenic
1172252578 20:33490181-33490203 CCCGGGCCGCGGGTCGAGGCGGG + Intronic
1172359607 20:34302995-34303017 CGCAGACCGCGCGGCGGCCCCGG + Intronic
1172474399 20:35226542-35226564 CAGGGGCCGCGGAGCGGCGCTGG - Intergenic
1173279838 20:41618250-41618272 CCCGGCCGGCGGGGCGGGGCCGG + Intronic
1173516153 20:43666986-43667008 GCCAGGGGGCGGGGCGGGGCGGG - Intergenic
1173613630 20:44388781-44388803 CCCAGGGCGCAGGGCAGGGCAGG - Intronic
1173649129 20:44651795-44651817 TCCAGGCCGGCGGGCGGGGCGGG - Intronic
1174407741 20:50313013-50313035 CCCAGGCCGGGGGCCGGGGAGGG + Intergenic
1175215284 20:57389295-57389317 CCCAGGCGGCAGGGCAGCCCCGG - Intergenic
1175394735 20:58650497-58650519 CCCGGGGCACGGGGGGGCGCGGG + Intergenic
1175399520 20:58692711-58692733 CCCGGGGCGCGAGGGGGCGCCGG - Exonic
1175402079 20:58706713-58706735 CCCAGGCGGCGTGGCAGCCCGGG + Intronic
1175447444 20:59032653-59032675 GCGAGGACGCGAGGCGGCGCGGG + Intergenic
1175517247 20:59577461-59577483 CCGGGGCCGCGGGGAGGCGCCGG - Intergenic
1175715749 20:61253200-61253222 CCCAGCCCCCGGGGCCCCGCCGG - Intronic
1175715858 20:61253542-61253564 CCGAGGCCGCGGGGCGCTGGGGG + Intronic
1175856123 20:62122046-62122068 CCCAGGGTCCGGGGCGGCGCCGG + Intergenic
1175901708 20:62362437-62362459 TCCAGGCCGCGGGACAGCGGTGG + Exonic
1175924951 20:62466993-62467015 CCCAGGCCGGGGGGCCCCACCGG + Intronic
1176109953 20:63406633-63406655 CCCAGGAAGTGAGGCGGCGCTGG - Exonic
1176131603 20:63498875-63498897 CCCGGGGTGGGGGGCGGCGCGGG - Intronic
1176138348 20:63534767-63534789 CCCAGGCCCCAGGGAGGAGCGGG + Intronic
1176194599 20:63831372-63831394 CCGCGGCCGGGGCGCGGCGCGGG - Intergenic
1176372794 21:6072607-6072629 CACAGGCCCCAGGGAGGCGCAGG - Intergenic
1176380576 21:6110653-6110675 CGCAGGCCGCGTGGAGGGGCCGG + Intergenic
1176566765 21:8392109-8392131 CCCCGCCGGCGGCGCGGCGCAGG - Intergenic
1178327846 21:31659926-31659948 GCCAGGCCTCGGGGCCGCCCTGG + Intronic
1178334342 21:31731160-31731182 CTCAGGCCGCGGCGCGTCGACGG - Intronic
1178334650 21:31732218-31732240 CCCTGCACGCGGGGCGGTGCAGG - Intergenic
1179522465 21:41954015-41954037 CTCTGGCCGCGGGGCGGGGCGGG + Intergenic
1179742896 21:43427587-43427609 CGCAGGCCGCGTGGAGGGGCCGG - Intergenic
1179750683 21:43465636-43465658 CACAGGCCCCAGGGAGGCGCAGG + Intergenic
1179882706 21:44300202-44300224 TCCCGGCCGCGTCGCGGCGCAGG + Intronic
1180131778 21:45831213-45831235 CTCACTCCTCGGGGCGGCGCCGG + Intronic
1180181520 21:46120527-46120549 GCCAGGCCGCGGGGCCCCTCAGG - Exonic
1180843849 22:18971073-18971095 CCCAGTCCGCGAGGCGGGGGCGG - Intergenic
1181026739 22:20131516-20131538 CCCGGGCCGCGGAGCCGTGCAGG - Intronic
1182122550 22:27797227-27797249 CCCAGGCCGAGGGCGGGCGGGGG + Exonic
1182771790 22:32801690-32801712 CCCAGGCAGCGGCGCAGAGCGGG + Exonic
1183228146 22:36564285-36564307 CCCCGGGGGCGGGGCGGGGCGGG - Exonic
1183649491 22:39145790-39145812 ACCCGGCCGTGGGGCGGGGCGGG - Intronic
1183683770 22:39350209-39350231 CCCCGGCGGCGGCGCGGCGGCGG + Intronic
1183687065 22:39367285-39367307 CCCAGGCCCCAGGGCAGGGCAGG + Intronic
1183780260 22:39994897-39994919 CCCCGACGGCGGGGCGGGGCGGG + Intergenic
1183933610 22:41249596-41249618 CCCAGGCCTCGGGGCCCCGTGGG + Intronic
1184659819 22:45960577-45960599 CCCTGGCTGCCGGGCGGCCCTGG + Intronic
1184673371 22:46027427-46027449 CCCAGCCCGCGGCGCCGCGTGGG + Intergenic
1185228198 22:49665143-49665165 TGCAGGCCTGGGGGCGGCGCTGG - Intergenic
1185259515 22:49853815-49853837 CCCAGGGCCCCGCGCGGCGCGGG - Intergenic
1185296707 22:50058298-50058320 CCCGGGGCGTGGGGCTGCGCGGG + Intergenic
1185317635 22:50185887-50185909 CTGGGGCCGCGGGGCGGGGCGGG - Intergenic
1185336210 22:50271875-50271897 CCCAGTCCACGGGGAGGCGCAGG - Intergenic
950316312 3:12004657-12004679 CCCGGACCGGGGGGCGGCGGCGG - Exonic
952816763 3:37453032-37453054 CCCACCCCGCGCAGCGGCGCTGG - Intronic
952942297 3:38454077-38454099 CCCGGGCTCCGGGGCGACGCGGG - Exonic
953485068 3:43286895-43286917 GCCTGGCGGCGGGGCGGCGGCGG + Intronic
953485119 3:43287054-43287076 CCCAGGGCGCGGGGCCCCGCGGG - Intronic
954305698 3:49724206-49724228 CCGGGGCCGTGGGGCGGGGCCGG - Intergenic
954367704 3:50155172-50155194 CCCGGGCCGGGCGGCCGCGCTGG - Exonic
954618600 3:51983272-51983294 CGCAACTCGCGGGGCGGCGCTGG + Exonic
954733485 3:52685628-52685650 CCCCGGCCGTGGGGACGCGCGGG - Intronic
954838896 3:53494524-53494546 GCCGGGGCGCGGCGCGGCGCGGG + Intergenic
955060832 3:55489992-55490014 CCCTGCCCGCGGGGCGGGGCTGG - Intergenic
956452289 3:69386333-69386355 CCCAGGGCGCGGGGCAGGGACGG + Intronic
960942388 3:122943332-122943354 CCCAGCACGCGGGGCTGCCCAGG + Intronic
961028917 3:123585122-123585144 CCAGGGCCGCGGGGCGGAGCCGG + Exonic
961574493 3:127823320-127823342 CCCGGCCCGCGGGGAGGAGCGGG + Intergenic
962809772 3:138950169-138950191 GCCAGGCTGCGAGGAGGCGCGGG - Intronic
963116978 3:141738536-141738558 CGGAGGCCGCAGGGCGGCCCTGG - Intronic
964771254 3:160225993-160226015 CCCGGGCCTCCGGGGGGCGCCGG + Exonic
968093046 3:195909773-195909795 CCCCCACCCCGGGGCGGCGCAGG - Intronic
968506531 4:973591-973613 CGCGGGCCGCGGGGCGGGGCGGG + Intronic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
968651990 4:1763816-1763838 CTCTGGCCGCGGGGCCGGGCCGG + Intergenic
968986927 4:3880605-3880627 CCCAGGCCTGGTGGCGGGGCGGG - Intergenic
969075601 4:4575434-4575456 CGCGGGCCGCCTGGCGGCGCTGG + Intergenic
969360308 4:6658982-6659004 CCGAGCCGGCGGGGCAGCGCGGG + Intergenic
971351876 4:25862817-25862839 GCCATGCAGCGGCGCGGCGCGGG - Exonic
973292440 4:48483680-48483702 CCCAGGGCCGGGGCCGGCGCTGG - Exonic
973773536 4:54226809-54226831 CCCAGGACCCGGGGCGTCGTGGG + Intronic
976199042 4:82561636-82561658 CGCAGGTCGCGGGGCAGAGCCGG + Intronic
978490089 4:109302873-109302895 CCCAGCCCGCGGGCCGGCCCGGG + Intergenic
980930262 4:139177359-139177381 CCCACGCGGCGGGGGGGCGGGGG + Intergenic
983533418 4:168833067-168833089 CCCCAGCCCCGGGGCGGGGCCGG - Intronic
984961091 4:185099501-185099523 CCCAGGCCTGGGGGCTGAGCCGG + Intergenic
985537332 5:472722-472744 CCCAGGCCGCTTGCGGGCGCTGG + Exonic
985794503 5:1952248-1952270 CCCTGGCTGAGGGGCGGGGCTGG + Intergenic
986449222 5:7849927-7849949 CCCAGCCCGCTGGGCGGCCCCGG + Intronic
986721493 5:10564001-10564023 CCCATCCCGCGGGCCGGCGGAGG + Intergenic
988577926 5:32444551-32444573 CCCGGGCAGCGGGGAGCCGCGGG - Intronic
989571591 5:42951095-42951117 CGCAGTCCGTGCGGCGGCGCTGG + Intergenic
989631082 5:43483600-43483622 CCAGGGCCGCGGGACGGTGCCGG + Intronic
991474374 5:67004164-67004186 CCCAGGCTGCGGGGCTGTCCCGG + Intronic
992473263 5:77077754-77077776 CCCAGGCGGCCGGGAGGCGTCGG + Exonic
992627761 5:78649581-78649603 CCCAGCCCTGGGGGCGGAGCTGG - Intronic
992910736 5:81393954-81393976 CCGGGGCTGCGGGGAGGCGCGGG - Intronic
994171349 5:96662445-96662467 CCGGGGCCGCGGGGAGGCGGCGG - Exonic
996432830 5:123400864-123400886 CCCAGGCTCTGGGGCAGCGCAGG + Intronic
997549413 5:134738771-134738793 CACAGGCCCGGGAGCGGCGCGGG + Exonic
999655612 5:153807755-153807777 CCCAGGCAGAGGGGAGGGGCAGG - Intronic
999767971 5:154755409-154755431 CCCCGCCCCCGGGGCGGCCCGGG - Intronic
1001382261 5:171312395-171312417 CGAAGGCCGCGGGCCAGCGCCGG + Intergenic
1002158899 5:177303519-177303541 CCCAAGCCTCGGGGCGGCCTGGG + Exonic
1002170314 5:177371039-177371061 TCCGGGCCGCGGGGCGGGGCGGG + Intronic
1002455954 5:179345438-179345460 CGCAGGGCGCGGGGCGGAGGAGG + Intergenic
1002523970 5:179805813-179805835 ACCGGCCAGCGGGGCGGCGCGGG + Intronic
1002638389 5:180619197-180619219 CCCCGGGCGCGGGGCGCCGCGGG - Intronic
1003074388 6:2971089-2971111 CCGAGGCCGCGGGGCCGACCGGG + Intronic
1003098940 6:3162794-3162816 CAGAGGGCGCTGGGCGGCGCCGG + Intergenic
1003212310 6:4079044-4079066 CGAAGCCCGCGGGCCGGCGCAGG + Exonic
1003871176 6:10404464-10404486 CCCCGGCCGCGGGGCGGGGCGGG + Intronic
1003942671 6:11044371-11044393 CCGAGGGGGCGGGGAGGCGCGGG - Intergenic
1005526804 6:26659452-26659474 CCCAGGCCTAGGGGCGGCGCCGG - Exonic
1006177508 6:32131302-32131324 CCGAGGCGGCGGGGGGGGGCGGG + Intergenic
1006834092 6:36986260-36986282 TCCAGGCCGCGGGGGAGCTCGGG + Exonic
1006932800 6:37697751-37697773 CCAAGGCCGCCGGGCGGGGGCGG - Exonic
1007431513 6:41779903-41779925 CCGCGGCCGCGGGGCGGGGCGGG - Intronic
1007605340 6:43113984-43114006 CACAGGCCCCGGGGCTGCTCAGG - Intronic
1007625464 6:43243859-43243881 TCCAGGCCTCGGCGCGGCCCAGG - Intronic
1007631435 6:43275430-43275452 CCCTGGCCCCGGGGCGGGGGCGG + Intronic
1007785264 6:44276189-44276211 GCCAGCCCGCGGGCCGGCCCGGG + Exonic
1012895507 6:104941471-104941493 CGCAGGCCACGCGGGGGCGCAGG + Intergenic
1014233981 6:118935032-118935054 CACCGGCCGCGGGGACGCGCGGG + Exonic
1016949664 6:149566991-149567013 CCGAGGCTGCGGGGCTCCGCCGG + Intronic
1017793637 6:157823069-157823091 CCGGGGCGGCGGCGCGGCGCGGG + Intronic
1018960160 6:168441872-168441894 GACAGTCCGCGGGGCGGCGCCGG - Intronic
1019032369 6:169024342-169024364 CCCCGGCCGCGCAGCGGAGCAGG + Intergenic
1020137379 7:5594579-5594601 CCTGGGCCCGGGGGCGGCGCGGG - Intronic
1022113081 7:27243249-27243271 CGCAGGCAGCGCGGCGGGGCCGG + Exonic
1022271140 7:28809236-28809258 CCCAGCCCACAGGGGGGCGCCGG + Exonic
1022375227 7:29806424-29806446 TCCCTGCCGCGGGGCGGCGGCGG + Intergenic
1022629374 7:32070899-32070921 CGCTGGGCGCGGGGCGGAGCCGG - Intronic
1023360920 7:39414484-39414506 CCCAGGCCTCAGGACGGCGAGGG - Intronic
1025174010 7:56787670-56787692 CCCAGGTCGCGGGGAGGAGGTGG - Intergenic
1025698091 7:63790285-63790307 CCCAGGTCGCGGGGAGGAGGTGG + Intergenic
1025829805 7:65038755-65038777 CCCAGGCCGCGGGGCGGAGGTGG + Intergenic
1025917060 7:65873755-65873777 CCCAGGCCGCGGGGCGGAGGTGG + Intronic
1026017547 7:66682697-66682719 CCCCGGCCGCGGCAGGGCGCCGG + Intronic
1026091212 7:67302409-67302431 CCCAGGCCCCGAGGCGGATCGGG - Intergenic
1026740681 7:72976527-72976549 CCCAGTCCCCGGGGGGGCGCAGG - Intergenic
1026968368 7:74454118-74454140 TCCTGGCCGCGGGCCGGGGCCGG + Exonic
1027103051 7:75388544-75388566 CCCAGTCCCCGGGGGGGCGCAGG + Intergenic
1027224486 7:76235303-76235325 AGCAGGCCGCGGGGCGGGACTGG + Intronic
1027260557 7:76461882-76461904 CCAGGGGCGCGGGGTGGCGCGGG + Intronic
1027311936 7:76959995-76960017 CCAGGGGCGCGGGGGGGCGCGGG + Intergenic
1027774018 7:82443317-82443339 CGCCGGCCGAGGGGCGCCGCGGG - Intronic
1029363239 7:100101651-100101673 CCGGGGCCGCAGGGCGGGGCAGG + Exonic
1029420085 7:100467770-100467792 CCCAGGCCCCGGTGGGGCGGGGG + Intronic
1032087526 7:128891671-128891693 CCCAGGCAGCGGGTGGGCACAGG + Exonic
1032953087 7:136938720-136938742 CCCAGGCTCTGGGGCAGCGCAGG - Intronic
1033283452 7:140021849-140021871 GACAGGCCGGGGGGCGGGGCCGG - Intergenic
1034278904 7:149838345-149838367 CCCAGGCGGCGGGGCGTGACGGG - Exonic
1034421623 7:150993834-150993856 CCCAGGCCGCAGGGTGGCCCAGG - Exonic
1034470479 7:151251951-151251973 CCCAGGCCGGGGACCGGCGCGGG - Intronic
1034617923 7:152435513-152435535 CCCACCCCGCCGGGGGGCGCCGG + Intronic
1035153207 7:156892622-156892644 CCGAGGCCGCGGGGCGGGGGCGG + Intronic
1035625686 8:1068909-1068931 CCCAGCCCCCGGGGCTGCCCAGG - Intergenic
1035679735 8:1479107-1479129 CCCAGGCAGGGGGGCAACGCTGG + Intergenic
1035752007 8:2002733-2002755 CGCAGGCGGCGGGGCCGAGCGGG + Exonic
1036637772 8:10563778-10563800 CCCAGGCAGAGGGGCAGCGATGG - Intergenic
1037957158 8:23068816-23068838 CCCAGGACCCAGGGAGGCGCGGG - Exonic
1037977655 8:23224821-23224843 CCCAGGACCCAGGCCGGCGCGGG - Exonic
1039531766 8:38269064-38269086 CCCAGGCAGGCGGGCGGCACGGG - Intronic
1039884312 8:41646606-41646628 CCCCGGGCCCCGGGCGGCGCGGG - Exonic
1041449783 8:57994596-57994618 CCCAGGACGCGCGGCCGCGAAGG - Exonic
1042040045 8:64580765-64580787 CCCGGGCTGCGCGCCGGCGCGGG + Exonic
1043388185 8:79768092-79768114 CGCGGGCGGCGGGGAGGCGCGGG + Intergenic
1045489091 8:102655753-102655775 CCCCGCCCGCGGCGCGGGGCAGG - Exonic
1049288585 8:141789953-141789975 CCCAGCCAGCGGGGCGGCAGCGG - Intergenic
1049396711 8:142404208-142404230 CCCAGCCAGCGGGGCGGTGGGGG - Intergenic
1049407298 8:142457467-142457489 CCCAGGCAGCTGGGTGGGGCTGG + Intronic
1049454263 8:142679012-142679034 CCCAGCCCGCTGGGCGGTGGTGG - Intronic
1049509007 8:143018483-143018505 CCCAGGCAGCCGCGCGGCCCCGG - Intronic
1049657398 8:143804872-143804894 CAGAGGGCGCGGGGCGGGGCAGG + Intronic
1049896128 9:113513-113535 CCGGCTCCGCGGGGCGGCGCGGG + Intergenic
1049905706 9:214760-214782 GCCAGGCCGGGTGGCGGAGCCGG + Exonic
1051641799 9:19230667-19230689 CCCTGCCCGCGAGGCGGCGCAGG + Exonic
1053398902 9:37800732-37800754 CGGTGGCCGAGGGGCGGCGCGGG + Exonic
1053739251 9:41123605-41123627 CCCAGGAAGCTGGGCTGCGCTGG - Intergenic
1054689099 9:68307717-68307739 CCCAGGAAGCTGGGCTGCGCTGG + Intergenic
1056170505 9:83980367-83980389 CCCAGCCCGAAGGGAGGCGCTGG - Intronic
1056386191 9:86099282-86099304 CGCAAGCCGCGGGGAGGCTCCGG + Intronic
1056560558 9:87726047-87726069 GCCAGGCGGCGGGGCGGTGCCGG + Exonic
1057259566 9:93576360-93576382 CCCAGGCCGGCGGGCGGAGGCGG + Intergenic
1057488603 9:95506021-95506043 GCCGGGCCGCGGAGCGGGGCCGG + Intronic
1057682253 9:97199857-97199879 CCCAGGCCTAGGGGCGGCGCCGG - Intergenic
1057708060 9:97412105-97412127 CCCAAGCCGCGGGGCGGCTCCGG + Exonic
1057773352 9:97985072-97985094 CCCCCGCCGCGGACCGGCGCGGG + Intronic
1059208454 9:112487389-112487411 GCCGGGCGGCGGGGCGGCCCGGG - Intronic
1059414735 9:114155810-114155832 CCCTGGGCGCGGGGCTGCGCTGG + Exonic
1059437099 9:114283606-114283628 GCCAGGCTGCTGGGCGGAGCGGG + Intronic
1060305350 9:122406286-122406308 CCCACGGCGCGGGGCGGCTCAGG + Intergenic
1060608627 9:124940852-124940874 CCCAAGGCGGGGGGCGGCACCGG - Intronic
1060827466 9:126695224-126695246 CCGAGGCCGCTGGGAGCCGCTGG - Intronic
1061208213 9:129176457-129176479 CCCTGGCCGCCGGGGCGCGCCGG - Exonic
1061275808 9:129568926-129568948 CCAAGCCCGCTGGGCGGGGCGGG - Intergenic
1061453424 9:130681227-130681249 CTCTGGCCGCGGGGCGGGGCGGG - Exonic
1061781170 9:132996799-132996821 CCCAGGACGCGGGGTGGGGTGGG - Intergenic
1061950954 9:133935554-133935576 ACCAGGCCGCAGGGAGGAGCTGG + Intronic
1061975963 9:134068159-134068181 CCCGGGGCGGGGCGCGGCGCCGG - Intronic
1062007839 9:134250385-134250407 CCCAGACCTAAGGGCGGCGCTGG + Intergenic
1062352232 9:136144857-136144879 CCCAGGACGTGGGGCGGCACTGG - Intergenic
1062364730 9:136203219-136203241 GCGGGGCCGCGGGGCGGGGCGGG + Intronic
1062368595 9:136224439-136224461 CCCAGGGCGCGGCGAGGAGCAGG + Intronic
1062499341 9:136845596-136845618 CCCAGGCCGGGCTGCTGCGCGGG - Exonic
1062499572 9:136846502-136846524 CCCAGTCCTCGCGGCGGCACAGG - Exonic
1062542042 9:137045837-137045859 CGCAGGCCGCGGGGCGCCCCGGG - Intronic
1203782172 EBV:106664-106686 CCCAGACCGCAGGGCGGTGGTGG - Intergenic
1185508228 X:644318-644340 CCGGGGGCGCGGGGCGGAGCAGG + Intronic
1187900908 X:24025754-24025776 GCCGGGACGCGGGGCGCCGCGGG - Intronic
1190324859 X:49200100-49200122 CCTAGGCAGCCGGGCGGCGGCGG + Intronic
1190385639 X:49879966-49879988 CCCCGGCCCCGGCGCGGCCCTGG + Exonic
1195269477 X:103215587-103215609 CCAGGGCCTCGGGGCGGGGCGGG + Intronic
1196124328 X:112082931-112082953 TCCTGGCGGCGGGGCGGGGCGGG + Intergenic
1196783042 X:119399743-119399765 TCCAGGCAGCAGGGCGGCGTCGG - Intronic
1196965223 X:121047794-121047816 CCCCGGCTGCGAGGCGGCGGCGG - Exonic
1198388097 X:136147551-136147573 CCGAGGCCGAGGCGCGGCGGTGG - Exonic
1200093864 X:153648198-153648220 ACCAGGGCGGGGGCCGGCGCCGG + Exonic
1200155321 X:153971952-153971974 CCCCCGCCGCGAGGCAGCGCAGG - Intergenic
1202197122 Y:22307579-22307601 CCCAGGCCGCGGGACATCCCCGG - Intergenic