ID: 935645334

View in Genome Browser
Species Human (GRCh38)
Location 2:105329677-105329699
Sequence CAGGAGCCGCGGGCCGGAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 1, 2: 8, 3: 49, 4: 400}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935645334_935645353 22 Left 935645334 2:105329677-105329699 CCCGCTCCGGCCCGCGGCTCCTG 0: 1
1: 1
2: 8
3: 49
4: 400
Right 935645353 2:105329722-105329744 CCGCTTCCCGTCACGTGGGGCGG 0: 1
1: 0
2: 4
3: 17
4: 58
935645334_935645356 30 Left 935645334 2:105329677-105329699 CCCGCTCCGGCCCGCGGCTCCTG 0: 1
1: 1
2: 8
3: 49
4: 400
Right 935645356 2:105329730-105329752 CGTCACGTGGGGCGGCCGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 107
935645334_935645348 17 Left 935645334 2:105329677-105329699 CCCGCTCCGGCCCGCGGCTCCTG 0: 1
1: 1
2: 8
3: 49
4: 400
Right 935645348 2:105329717-105329739 AGCCGCCGCTTCCCGTCACGTGG 0: 1
1: 0
2: 1
3: 3
4: 54
935645334_935645349 18 Left 935645334 2:105329677-105329699 CCCGCTCCGGCCCGCGGCTCCTG 0: 1
1: 1
2: 8
3: 49
4: 400
Right 935645349 2:105329718-105329740 GCCGCCGCTTCCCGTCACGTGGG 0: 1
1: 0
2: 1
3: 11
4: 57
935645334_935645351 19 Left 935645334 2:105329677-105329699 CCCGCTCCGGCCCGCGGCTCCTG 0: 1
1: 1
2: 8
3: 49
4: 400
Right 935645351 2:105329719-105329741 CCGCCGCTTCCCGTCACGTGGGG 0: 1
1: 0
2: 1
3: 14
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935645334 Original CRISPR CAGGAGCCGCGGGCCGGAGC GGG (reversed) Exonic
900185849 1:1332904-1332926 CAGGAGCTGCGGGCGGGGGACGG - Exonic
900213161 1:1467377-1467399 CAGGAGACACTGACCGGAGCCGG - Intronic
900998474 1:6135430-6135452 CAGGAGCAGAGGACCGGGGCAGG + Intronic
901018018 1:6242641-6242663 CAGGGCCCGCGGGCCAGATCCGG - Intergenic
901054042 1:6440466-6440488 CAGGGGAGGCGGGGCGGAGCCGG + Intronic
901533479 1:9867736-9867758 CAGGATGCGGGGGCCAGAGCAGG - Intronic
903161303 1:21491059-21491081 CTGGAGCCCTGGGCCAGAGCAGG + Intergenic
903231820 1:21926979-21927001 CAGGAGGTGGGGGCCGGAGCCGG + Intronic
905215084 1:36401162-36401184 CAGGAACCACGGGCCAGAGCAGG - Intergenic
905895477 1:41543222-41543244 CAGGATCAGCAGGCAGGAGCAGG - Intronic
905927513 1:41762447-41762469 CTGGATCCGCAGGCTGGAGCAGG + Intronic
905986728 1:42291926-42291948 GAGGAGCCGAGGGCAGGAGCCGG + Intronic
906292911 1:44631712-44631734 CAGGAGGCGGGAGCCGGGGCCGG + Intronic
910000038 1:82330802-82330824 CCGGAGCTGCAGGCCGGAGCAGG - Intergenic
912167474 1:107057508-107057530 CAGGAGCTGGAGGCCGGAGTGGG + Exonic
912587847 1:110783108-110783130 CAGGAGCCCAGGTCAGGAGCCGG - Intergenic
912881692 1:113422827-113422849 CAGGAGCTGCAAGCCAGAGCTGG - Intronic
913209451 1:116570856-116570878 CAGTACCCGCCGGCCGGCGCGGG + Intronic
915285212 1:154847962-154847984 CAGCAGCAGCGTGCTGGAGCCGG - Intronic
915367328 1:155323525-155323547 CAGCAGCCGCAGCCCGGCGCCGG - Intronic
915526530 1:156479656-156479678 CAGGAGCCGCGGGTCCGTGAGGG + Exonic
917531701 1:175841809-175841831 CAGGAGCCTCAGGCAGGAGTAGG - Intergenic
918275778 1:182952902-182952924 CCTGAGCCGCGGGCAGGCGCTGG + Exonic
918437737 1:184533780-184533802 CAGGAGGCCCTGGCCGGGGCTGG + Intronic
921650723 1:217674746-217674768 CTGGAGCCACAGGCCAGAGCAGG - Intronic
923782991 1:237042408-237042430 CGGGAGCCGGGGGCTGGAGGGGG - Exonic
924172439 1:241356756-241356778 CGGGAGCCCCGCGCCGGGGCTGG - Intronic
924423131 1:243927973-243927995 CAGGAGCCACGGGGCTGAGGTGG + Intergenic
924436708 1:244049001-244049023 CAGGGGCCAGGGGCCGGCGCCGG - Intronic
924527149 1:244863306-244863328 GAGGAGCCGCGGGCGGGCGGCGG - Intronic
1065993255 10:31032491-31032513 CGGGAGCCAGGGGCGGGAGCCGG - Intergenic
1066129674 10:32380457-32380479 CAGGAGACGCGGCCCAGAGAGGG - Intergenic
1067060923 10:43077522-43077544 CGGGCGCCTCGGGCCGGGGCTGG + Intronic
1067258609 10:44666687-44666709 CAGGAGCCACAGGCCAGAGCAGG - Intergenic
1068287791 10:54962339-54962361 CAGGAACTGTGGGCCAGAGCAGG + Intronic
1069889430 10:71643967-71643989 CAGGAGCTGGGGGCCTGAGAGGG - Intronic
1070329183 10:75405659-75405681 CAGGAGCCGCGGCCCGGCCCGGG + Intergenic
1071874420 10:89829374-89829396 CAAGCTCCGCGGGCAGGAGCTGG + Intergenic
1072638881 10:97196231-97196253 CCGACGCCGCGGGCCGGGGCTGG - Intronic
1073147949 10:101292600-101292622 GCGCGGCCGCGGGCCGGAGCGGG - Intergenic
1073444182 10:103571126-103571148 CAGGAGGCGGGGGCGGGGGCAGG - Intronic
1074088346 10:110225884-110225906 CGGCAGCCGCGGGCGGGTGCGGG + Intronic
1074215681 10:111381588-111381610 CAGGAGCCATGGGCCAGAGTGGG - Intergenic
1074843266 10:117375395-117375417 GAGGAGGCGCGGGCCGCTGCGGG - Exonic
1074923830 10:118046854-118046876 TAGGAGCCGCCGGCCGGGCCAGG - Intergenic
1075259260 10:120949032-120949054 AGGGAGCCGCGGCCCCGAGCTGG + Intergenic
1075571624 10:123550662-123550684 CAGGAGACCCGGGTTGGAGCGGG - Intergenic
1076198810 10:128541256-128541278 CAGGCTCCGCGCGCGGGAGCTGG + Intergenic
1076730168 10:132434572-132434594 CAGGGGCCGCCGTCCGGAGGCGG - Intergenic
1076890224 10:133279795-133279817 CAGGAGCCGGGGGCCCCCGCAGG + Exonic
1077008847 11:371165-371187 CAGGTGCCCTGGGGCGGAGCTGG - Intronic
1077496916 11:2890938-2890960 CAGGAACCGATGGGCGGAGCTGG + Intronic
1078360516 11:10664277-10664299 CAGGAGGCGGGGACCTGAGCTGG - Intronic
1080351133 11:31386802-31386824 CAGGAGCCACAGTCTGGAGCTGG - Intronic
1080485804 11:32705154-32705176 CAGGAGCCGCGGGCTGAAGCAGG + Intronic
1081740088 11:45433042-45433064 CAGGAGGCGCGGCCTGGGGCTGG + Intergenic
1081860991 11:46333246-46333268 CAGGAGCCGCGGGCGGAAGGCGG + Intronic
1081870720 11:46381539-46381561 CGGGGGGCGCGGGCTGGAGCGGG + Intronic
1083140670 11:60718678-60718700 CAGGAACTGTGGGCTGGAGCAGG - Intergenic
1083310365 11:61780745-61780767 CAGGGGGCTGGGGCCGGAGCAGG - Exonic
1083421002 11:62553300-62553322 CAGGAGCCGAGGGAGGGAGTTGG + Intronic
1083936650 11:65872959-65872981 CAGGAGCCGCCTCCCGGCGCCGG + Intronic
1084165583 11:67373421-67373443 CGGGAGCCCCGCGCCGGGGCCGG - Intronic
1084165742 11:67373934-67373956 CAGGAGCCGGGGGACAGCGCCGG + Intronic
1084284111 11:68120770-68120792 CAGGTGACGCGGGGCGGGGCCGG - Intronic
1084749289 11:71193641-71193663 CAGGTGCCCAGGGCCGGAGCAGG - Intronic
1084758378 11:71252733-71252755 CCGCAGCCGCGGGCGGGAGCGGG - Intergenic
1085317680 11:75555283-75555305 CAGGGGCCTCGGGCTGGAGAGGG - Intergenic
1085740028 11:79070370-79070392 AAGGAGCCCTGGGCCAGAGCTGG - Intronic
1086850271 11:91799919-91799941 CAGGAGCCATGGGCCAGAGTGGG + Intergenic
1088287671 11:108204679-108204701 CAGGAGCCGCAAGCCAGAGTGGG + Intronic
1088400932 11:109422380-109422402 CAGGGGCCGGGGGCAGGGGCGGG - Intronic
1088801903 11:113314498-113314520 CAGGAGCCAGGGCCCGGGGCGGG - Intergenic
1089078841 11:115760041-115760063 CAGAAGCCGGCGGCAGGAGCGGG + Intergenic
1089333234 11:117704576-117704598 CAGGAGCTGCGGGGAGGAGGGGG + Intronic
1091840220 12:3615282-3615304 CAGGAGCCGTGTGCAGGATCAGG + Intronic
1091851187 12:3698481-3698503 CAAGAGCTGTGGGCCAGAGCTGG + Intronic
1096466190 12:51848693-51848715 CGGCCGCCGCGGGCGGGAGCGGG + Intergenic
1096796739 12:54082567-54082589 CCGGGGCCGGGGGCCGGGGCCGG + Intergenic
1100260492 12:92928792-92928814 ACGGAGCCCCGCGCCGGAGCGGG + Intronic
1101325161 12:103709329-103709351 CAGGAGCAGTGGGCAGGCGCCGG + Intronic
1103239115 12:119398309-119398331 TAGGAGCGGCTGGCCGGTGCCGG - Intronic
1103509713 12:121466564-121466586 TGCGAGCCGCGGGCCGGCGCGGG - Intronic
1103698702 12:122836104-122836126 TAGGAGACGGGGGCAGGAGCCGG - Intronic
1103699192 12:122839890-122839912 CGGTAGCCGCTGGCCGGTGCGGG - Intronic
1104049631 12:125186729-125186751 CGGGAGCCGCGGGCCGGGCCGGG + Intergenic
1104656428 12:130576892-130576914 CAGGAGTCGCGGGGTGGAACAGG + Intronic
1104709383 12:130974806-130974828 CGGGAGCGGGGGTCCGGAGCAGG - Intronic
1104774363 12:131383111-131383133 CAGCAGCCGCAGGAGGGAGCAGG - Intergenic
1104854315 12:131894919-131894941 GCGGAGGCGCGGGCCGGGGCGGG - Exonic
1105031409 12:132887159-132887181 CCGGGGCCGGGGGCCGGGGCCGG - Intronic
1105388986 13:19958498-19958520 CAGGAGTCGAGGGCCGGCGGAGG + Intergenic
1106304264 13:28495640-28495662 CAGGAGCGGCGGGACAGCGCGGG - Intergenic
1106614110 13:31310611-31310633 CAGGAGCCACGGGCTGGAGTGGG + Intronic
1108063258 13:46553359-46553381 CAGGAGCGGCGGGGCGGGGTGGG + Exonic
1110730707 13:78876335-78876357 CAGGAGCCTCAGGCCAGAGTGGG - Intergenic
1111091594 13:83453510-83453532 CAGGAGCCATGGGCCAGAGCTGG + Intergenic
1111232570 13:85363151-85363173 TGGGAGGCGCGGGCGGGAGCCGG + Intergenic
1111396237 13:87672442-87672464 TAGGGGCCGGGAGCCGGAGCCGG - Intergenic
1111567339 13:90032927-90032949 CAGGAGCCACAGGCCAAAGCAGG + Intergenic
1112388049 13:98958299-98958321 GAGGTGCCGTGGGCTGGAGCTGG - Intronic
1113302126 13:109033771-109033793 CAGGAGCTGAGGGCAGGAGGTGG + Intronic
1113768399 13:112894475-112894497 GAGGGGGCGCGGGGCGGAGCCGG + Intronic
1113861723 13:113491175-113491197 CAGGACCCGAGGGGCGGAGGGGG - Exonic
1113874303 13:113584912-113584934 CGGGAGCCGCGGGCGGGAGCCGG + Intronic
1114055633 14:18965213-18965235 CAGGTGGCGAGTGCCGGAGCTGG + Intergenic
1114106913 14:19436550-19436572 CAGGTGGCGAGTGCCGGAGCTGG - Intergenic
1114187372 14:20413213-20413235 CCGGAGCCGCCGGGAGGAGCAGG + Intronic
1114525693 14:23365920-23365942 CAGGGGCCGAGGGTGGGAGCGGG - Intergenic
1114640018 14:24213361-24213383 CAGGAGGCGCTGGCTGGTGCAGG - Intronic
1115243310 14:31270423-31270445 CTGGAGCCAAGGGCCAGAGCTGG + Intergenic
1118285260 14:64465373-64465395 CCGGAGGCGCGGGGCGGCGCGGG - Intronic
1118736525 14:68705164-68705186 CAGGAGCCCCAGGCTGGATCAGG + Intronic
1119500899 14:75126794-75126816 CAGGGGCCGCGAGCCGGCGGCGG - Exonic
1120422261 14:84302959-84302981 CAGAAGCCACGGCCTGGAGCAGG + Intergenic
1122216491 14:100208248-100208270 CAGGAGCCCCGGTGGGGAGCGGG + Intergenic
1122532483 14:102438235-102438257 CAGGAGCGGCGAGCGGGAGCAGG - Intronic
1122624211 14:103075813-103075835 GAGGCGCCGCGGAGCGGAGCGGG - Intergenic
1122640818 14:103158135-103158157 CAGGATCCACAGGGCGGAGCAGG - Intergenic
1122770531 14:104095752-104095774 CAGGAGCTGCTGGGCTGAGCAGG - Intronic
1123004373 14:105314435-105314457 CGGGAGCCGCGGGCAAGGGCCGG - Exonic
1123197044 14:106627113-106627135 CAGGAGGCCCGGTCAGGAGCAGG - Intergenic
1123694461 15:22868028-22868050 CAGGAGCCACAGGCTGGAACAGG - Exonic
1124129390 15:26971210-26971232 CTGGAGCCGCGAGCGGGCGCGGG - Intergenic
1124340316 15:28886025-28886047 CGGCAGCCGCAGGCCGGTGCGGG + Exonic
1124512053 15:30335904-30335926 CAGGAGCCACGGGACGCAGGCGG + Intergenic
1124730861 15:32194847-32194869 CAGGAGCCACGGGACGCAGGCGG - Intergenic
1124945582 15:34262559-34262581 AAGCAGCAGCGGGCGGGAGCAGG + Intronic
1125516316 15:40323310-40323332 TCGGAGCCTCGGGGCGGAGCGGG + Intergenic
1125577900 15:40767617-40767639 CAGCTGCCCCGGGCCGGAGCTGG + Exonic
1125834255 15:42736489-42736511 CAGGAGGCGGGGCCCGGGGCCGG - Exonic
1125918585 15:43510844-43510866 CCGCAGGGGCGGGCCGGAGCTGG - Intergenic
1126348078 15:47717497-47717519 CAGCAGCAGCGGGACAGAGCAGG - Intronic
1126777607 15:52112808-52112830 CGGGGGCCGGGGGCCGGGGCGGG - Intergenic
1128681072 15:69652024-69652046 CAGGAGCCTGGGGCTGGGGCAGG + Intergenic
1129539107 15:76336708-76336730 CACTAGCCCCGGGCCGGAGCTGG - Exonic
1129606641 15:77028305-77028327 CAGGAGGCGGGGCCCGGGGCAGG + Intronic
1130115219 15:81000673-81000695 CAGAGCCCCCGGGCCGGAGCAGG + Intergenic
1131696492 15:94882524-94882546 CAGGAGCTGTGGGCCAGAGCTGG - Intergenic
1131829626 15:96345774-96345796 CAGGGGCCGCGGGCAGCAGGAGG + Intergenic
1132252074 15:100341680-100341702 GAGGAGGCGCGGGCCGCGGCCGG - Intronic
1132588110 16:715022-715044 TAGCAGGCGCGGGGCGGAGCGGG - Intronic
1132603004 16:782235-782257 CAGGAGCAGGGAGCGGGAGCCGG + Intronic
1132616218 16:842268-842290 CAGGAGACGGGGGCCCCAGCAGG - Intergenic
1132641700 16:981110-981132 AAGGGGCCGCGGCTCGGAGCTGG - Intronic
1132641905 16:981874-981896 CAGGAGACGCGCACCGGGGCCGG - Exonic
1132698794 16:1213515-1213537 CAGGAGGCCTGGGCTGGAGCAGG - Intronic
1133129952 16:3670875-3670897 CCTGTGCCGCGGGCAGGAGCAGG - Intronic
1133259426 16:4538560-4538582 CAGGCGCCGCGGGCGGGGGCGGG + Intronic
1135016079 16:18926122-18926144 CCTCAGCCCCGGGCCGGAGCGGG - Exonic
1135437263 16:22437298-22437320 CCTCAGCCCCGGGCCGGAGCGGG + Intergenic
1136333169 16:29595047-29595069 CCTCAGCCCCGGGCCGGAGCGGG - Intergenic
1136447863 16:30335113-30335135 CCTCAGCCCCGGGCCGGAGCGGG - Intergenic
1137565418 16:49529785-49529807 GAGGAGCGGCGGGCTGCAGCGGG + Intronic
1137617468 16:49856167-49856189 CAGGGGCCGGGGGCCGGCGGGGG - Intronic
1138572381 16:57884220-57884242 CATGAGCCCGGGCCCGGAGCCGG - Exonic
1138651539 16:58463981-58464003 CGGGAGCCGCGGGGAGGAGGGGG - Intronic
1138689487 16:58754057-58754079 CCCGAGCTGCTGGCCGGAGCAGG - Intergenic
1138998325 16:62478741-62478763 CAGGAGCTGCAGGCTGGAGCAGG + Intergenic
1140209320 16:72958599-72958621 GAGGAGCCTGGGGCCGCAGCAGG - Exonic
1141563086 16:84883311-84883333 CGGGAGCCGCAGGCAGGAACAGG - Intronic
1141658337 16:85428234-85428256 CAGGAGCCCAGGGCCGGGGCTGG - Intergenic
1141802853 16:86322961-86322983 CAGAAGGCGCCGGCCAGAGCTGG - Intergenic
1141989881 16:87603530-87603552 TAGGTGCCGCGGGCCGGGCCGGG + Intronic
1142133013 16:88439343-88439365 CAAGAGCCTGGGACCGGAGCTGG + Exonic
1142136232 16:88453189-88453211 CAGGAGGCACGGGGCGGGGCCGG + Intergenic
1142434405 16:90047568-90047590 CAGCAGCCGCGGGACGGCCCGGG + Intergenic
1142763484 17:2054051-2054073 CAGGAGGTGCGGGGCGGAGGCGG + Intergenic
1142803839 17:2361466-2361488 CAGGAGCCGAGGGACGGGGAGGG + Intronic
1142855025 17:2724460-2724482 CAGGAGCCCCCGGACCGAGCCGG - Intergenic
1142876158 17:2853237-2853259 CGGGAGCTGCGAGCCGGGGCGGG + Intronic
1142967211 17:3589096-3589118 CAGGAGCCACCAGCTGGAGCTGG + Intronic
1143747233 17:9003465-9003487 CCGGGGTCGCGGCCCGGAGCAGG - Intergenic
1144773301 17:17771322-17771344 CATGAGCCCCTGGCCTGAGCAGG + Intronic
1145243517 17:21253036-21253058 CCCGGGCGGCGGGCCGGAGCCGG + Intronic
1146283314 17:31559097-31559119 CCGGTGCCGCAGGCTGGAGCGGG + Intergenic
1147994098 17:44351927-44351949 CAGGAGAGGCGGGCTGGAGTAGG + Intronic
1150060619 17:62065437-62065459 CCGGGGCCGAGGGCCGGAGGCGG + Intergenic
1150108702 17:62479396-62479418 CAGGAGCTGCGGTCCGGAGCCGG - Intronic
1150737219 17:67751210-67751232 CTGGAGCCTTGGGCCAGAGCAGG + Intergenic
1151772844 17:76176734-76176756 GAGGAGCCCCGAGGCGGAGCTGG + Intronic
1152392344 17:80010319-80010341 CGGGAGCCGCGGCCCGAGGCCGG - Exonic
1152455767 17:80415272-80415294 CAGGAGGCGGGGGCCGAGGCCGG + Intronic
1152588658 17:81200369-81200391 CAGGTGCAGCGGCGCGGAGCAGG - Exonic
1152591083 17:81212565-81212587 GAGGAGCCGTGGGCAGGAGTGGG + Intronic
1152628131 17:81397590-81397612 CGGGAGGCGCCGGCCGGGGCTGG + Intronic
1152729056 17:81961031-81961053 CAGGCCCGGCGGGCGGGAGCGGG - Exonic
1152908503 17:82983740-82983762 CAGGGGCCCCGGGGCGGAGGAGG + Intronic
1155519887 18:26657049-26657071 CAGGGGCCGCGGCCGGGGGCCGG - Intronic
1157338268 18:46756829-46756851 CAGGTGCCACGAGCCGGAGGCGG + Exonic
1160086188 18:75779593-75779615 CAGGAGCTAAGGGCAGGAGCAGG + Intergenic
1160164041 18:76495088-76495110 CAGGGGCCGCGGGCGGGCGGTGG - Intronic
1160234513 18:77075480-77075502 CAGGAGCAGCGGGCTGAAGGTGG + Intronic
1160322178 18:77905956-77905978 CAGGTGCCACGGGCGGGAGCTGG + Intergenic
1160454691 18:78992426-78992448 CAGGGGCCGCAGGCGGGGGCCGG - Exonic
1160512115 18:79458473-79458495 CAGGACCCGCCGCCCGGAGCCGG - Intronic
1160631232 18:80247476-80247498 CCGGTGCTGCGGGCCCGAGCTGG + Exonic
1160775519 19:853401-853423 CAGGTGCCGCCGGGCGGGGCGGG + Exonic
1160793651 19:934139-934161 CTGGAGGGGCGGGCAGGAGCCGG + Intronic
1160817862 19:1044563-1044585 CAGGAGCCGCTGGGGGGCGCAGG - Exonic
1161473401 19:4472471-4472493 CGGGGGCCCCGGGCCGGAGGCGG + Intronic
1161495527 19:4584079-4584101 CAGGAGCCCTGGGCGGGAGGAGG - Intergenic
1162013223 19:7830413-7830435 ACGGAGCCGCCGGCCTGAGCAGG - Intronic
1162046848 19:8005644-8005666 TCCGGGCCGCGGGCCGGAGCGGG - Intronic
1162413095 19:10517994-10518016 CCTGAGCCGGGGGCGGGAGCGGG - Intergenic
1162932039 19:13962258-13962280 CCTGAGCCCCGGGCCGGCGCAGG - Exonic
1163210489 19:15836614-15836636 CAGGATCCCCAGGCCGGAGGCGG + Intergenic
1163329803 19:16628813-16628835 CAGAAGCCGCCCGCCGTAGCTGG + Intronic
1163508521 19:17721924-17721946 CAGGAGCCGGGGGCGGCTGCAGG - Intronic
1163823289 19:19508487-19508509 CAGGAGCCACGGGGCCCAGCGGG - Exonic
1163851121 19:19664076-19664098 CAGGAGGCGGGGCCCGGTGCGGG + Intergenic
1165204612 19:34172821-34172843 AGGAGGCCGCGGGCCGGAGCGGG - Intronic
1165419850 19:35717487-35717509 CAGGAGGCGTGGGCTGGAGAAGG - Intergenic
1166084453 19:40465780-40465802 CAGGAACAACGGGGCGGAGCTGG + Exonic
1166329534 19:42070072-42070094 CTGGAGCCGGGGACTGGAGCCGG - Intronic
1166361639 19:42255025-42255047 CGGGAGCCGCGGCCCGGAATCGG - Exonic
1166677433 19:44748507-44748529 CAGGCGCCGCGGGCCGGGAGGGG + Intronic
1167048748 19:47066589-47066611 CAGCAGCCTTGGGCCGGGGCCGG + Exonic
1167437194 19:49486345-49486367 CTGGAGCCCCGGGCCGGCGCTGG + Intergenic
1168258587 19:55180240-55180262 GGGGAGCCGCGGAGCGGAGCAGG + Exonic
1168563526 19:57403668-57403690 CATGAGCCATGGGCTGGAGCAGG + Intronic
924999628 2:394558-394580 GAGGAGACGCGGGCCCCAGCGGG - Intergenic
925510635 2:4621737-4621759 CAGGAGATGCGGGCCTAAGCAGG + Intergenic
925931790 2:8714115-8714137 GAGGAGCCGAAGGCCGGAGCAGG - Intergenic
926130929 2:10302832-10302854 CCGGAGGCGGGGGCCGGGGCGGG - Intergenic
926155026 2:10448687-10448709 CAGCTGCCGCGGGCCGGGGCCGG - Intergenic
926430704 2:12782941-12782963 CAGGAGCCTCTGGCAGGTGCTGG + Intergenic
929590988 2:43146165-43146187 GAGGAGCCGCAGGTGGGAGCAGG + Intergenic
932331446 2:70900496-70900518 GAGGAGCAGCGGCCAGGAGCGGG + Intergenic
932492558 2:72131479-72131501 CATGAGCCGCGGGCCTTAGGCGG + Exonic
932873291 2:75425343-75425365 CTGGAGCCATGAGCCGGAGCAGG - Intergenic
933870000 2:86556877-86556899 CAGGATCTGCGGGTCGGACCCGG + Intronic
934853272 2:97714239-97714261 CAGGAGCCCAGGGACTGAGCAGG - Intronic
935645334 2:105329677-105329699 CAGGAGCCGCGGGCCGGAGCGGG - Exonic
935692628 2:105744915-105744937 CCGGAGCCGCGCGGCCGAGCGGG + Exonic
938368795 2:130756155-130756177 CGGGAGGGGCGGGCCGGCGCTGG - Intronic
940878468 2:158922163-158922185 CAGGGGGCATGGGCCGGAGCAGG - Intergenic
941978925 2:171434128-171434150 CAGCCTCCGCGGGCCGGAGGAGG + Intronic
942306309 2:174610787-174610809 GAGGAGCCGTGGTCAGGAGCTGG - Intronic
943247520 2:185474018-185474040 CACGAGCCACAGGCCGTAGCAGG + Intergenic
946954151 2:224910431-224910453 TAGGAGCCCAGGGACGGAGCTGG + Intronic
948631326 2:239304655-239304677 CAGGAGCCGAGGGCAGGACACGG - Intronic
948921759 2:241069177-241069199 CAGGAGCCGCTGGGCTGGGCTGG + Intronic
1168815497 20:733999-734021 CAGCGGCCTCAGGCCGGAGCAGG - Intergenic
1169171787 20:3471179-3471201 CAGGAGCGGCGGGCCGCACTGGG + Exonic
1169421610 20:5465165-5465187 CAGGAGCTGTGGGCTGGAGTTGG + Intergenic
1169832453 20:9839134-9839156 CAGGAGCCGGGAGCTGGAGCAGG + Intergenic
1170813001 20:19689413-19689435 CTGAAGCCAGGGGCCGGAGCTGG - Intronic
1172146713 20:32762644-32762666 GCGGAGCCGCGGGTCGGGGCTGG - Exonic
1172245638 20:33443562-33443584 CTGGAGCTGCGCGCCGGGGCGGG - Exonic
1172474399 20:35226542-35226564 CAGGGGCCGCGGAGCGGCGCTGG - Intergenic
1173740193 20:45394849-45394871 CAGGAGCCACAGGCCGGAGCAGG + Intronic
1174060909 20:47832540-47832562 CTGGAGACCCGGGGCGGAGCTGG - Intergenic
1174070989 20:47898830-47898852 CTGGAGACCCGGGGCGGAGCTGG + Intergenic
1174153069 20:48499828-48499850 CTGGAGACCCGGGGCGGAGCTGG - Intergenic
1174542931 20:51303983-51304005 CCGGAGCTGTGGGCTGGAGCGGG - Intergenic
1175992426 20:62796482-62796504 AAGGAGCCCCCGGCGGGAGCAGG - Exonic
1176131812 20:63499461-63499483 CAGACGCCGAGGACCGGAGCCGG + Intergenic
1176298024 21:5084761-5084783 CAGGAGCTGAGGCCGGGAGCAGG - Intergenic
1176306049 21:5123664-5123686 CAGGAGCTGCCGACCGGGGCCGG + Intronic
1176383469 21:6125573-6125595 CAGGAGCCATGGGCAGGGGCAGG + Intergenic
1177112860 21:17049491-17049513 CAGGAGCCATGGGCTGTAGCTGG - Intergenic
1178259814 21:31088563-31088585 GAAGAGGCGCGGGCGGGAGCCGG - Intergenic
1178367529 21:31999682-31999704 CAGGAGCCGGGGGCAGGCCCAGG + Exonic
1179740000 21:43412665-43412687 CAGGAGCCATGGGCAGGGGCAGG - Intergenic
1179851008 21:44138367-44138389 CAGGAGCTGCCGACCGGGGCCGG - Intronic
1179859005 21:44177188-44177210 CAGGAGCTGAGGCCGGGAGCAGG + Intergenic
1179909084 21:44438565-44438587 GAGGAGGTGCAGGCCGGAGCTGG + Intronic
1180001268 21:44996605-44996627 CAGGAGCCCGGGGCTGGGGCTGG + Intergenic
1180032982 21:45224664-45224686 CGGGAGCCCTGGGCCGGGGCAGG + Exonic
1180474109 22:15687765-15687787 CAGGTGGCGAGTGCCGGAGCTGG + Intergenic
1180620444 22:17158628-17158650 GAGGCTCCGCGGGCGGGAGCAGG - Intronic
1180649991 22:17369611-17369633 CAGGAGCCGAGGGCGGGCGCCGG - Exonic
1181006583 22:20016528-20016550 CTGGGGCCTCGGGTCGGAGCCGG - Intronic
1181269851 22:21652612-21652634 CTGGAGCCGCGGGCCGAGTCAGG + Intronic
1182116924 22:27761929-27761951 CAGGAGCTGGGGGCAGGACCGGG + Intronic
1182903983 22:33920841-33920863 CGGGCGCCGCTGGCCGGAGCCGG + Intronic
1183517048 22:38272761-38272783 CGGGAGCCGGCGGCCGAAGCCGG + Intronic
1183587544 22:38761466-38761488 CAGGAGCTGTGGGCTGGAGAGGG + Intronic
1183883341 22:40856238-40856260 CAGGAGCCGCGGGGAGCAGGAGG - Intronic
1184022906 22:41833066-41833088 CAGGGGGCGCGGGCTGGGGCGGG + Intronic
1184411893 22:44330871-44330893 CAGGGGCCGCGCGGCGGACCAGG + Intergenic
1184472664 22:44704524-44704546 CAGGTGCCGCGGGGAGGGGCTGG - Intronic
1184699890 22:46163709-46163731 CAGGAGCCCCGGGCAGGATGTGG - Intronic
1185062415 22:48613949-48613971 CAGGGGCCGCGAGCCGGGGGTGG - Intronic
1185271149 22:49929752-49929774 CAGGTGCAGCGGGCAGGGGCCGG - Intergenic
1185317635 22:50185887-50185909 CTGGGGCCGCGGGGCGGGGCGGG - Intergenic
950021712 3:9792416-9792438 CAGGGGCCGCGGGAGGGGGCGGG + Exonic
950654446 3:14427955-14427977 GAGGAGCCGAGGGCCAGATCAGG - Intronic
950726749 3:14921901-14921923 CAGGAGCTGCGGGCATGGGCTGG - Exonic
951509602 3:23486540-23486562 CAGGAGCCATGGGCCGGAGCAGG - Intronic
952644520 3:35639445-35639467 CCGGAGCTGCGGGGAGGAGCCGG + Intronic
954808310 3:53232795-53232817 CTGGAGCAGGTGGCCGGAGCTGG + Intronic
956761227 3:72446962-72446984 GGGGAGCCGCGGGCCGGATCTGG + Intergenic
959327620 3:104957092-104957114 CAGGAACCACAGGCCAGAGCGGG - Intergenic
959484692 3:106913396-106913418 CAGGAGATGCGGGCTGGAGCGGG + Intergenic
961028917 3:123585122-123585144 CCAGGGCCGCGGGGCGGAGCCGG + Exonic
962007374 3:131361936-131361958 CAGGGCCCGCAGGCTGGAGCTGG + Intergenic
962265503 3:133941696-133941718 AGGGAGCCGCTGGCCAGAGCTGG - Intronic
962763743 3:138542522-138542544 CAGGAGCCACTGGCCAGAGCAGG - Intronic
963028463 3:140942429-140942451 GAGGAGACGCGGGCAAGAGCTGG + Intronic
963870316 3:150408759-150408781 CGGGAGCCGCGGGCCGGAGCTGG - Exonic
966184193 3:177213484-177213506 CAGGAGCTGAGGGCTGGGGCGGG + Intergenic
967677498 3:192317287-192317309 CAGGAGCCAAGGCCTGGAGCTGG - Intronic
968114806 3:196081607-196081629 CCGGACCCGCAGCCCGGAGCCGG + Intronic
968511643 4:998218-998240 CAGCAGAGGCGGGGCGGAGCAGG + Intronic
968545188 4:1194619-1194641 CAGGTCCCGCGGGCCAGAGCAGG - Intronic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
968613465 4:1567296-1567318 CAGGACCGGCGGGCGGGTGCTGG + Intergenic
968658653 4:1789686-1789708 CAGGAGACGCGGGTGTGAGCGGG + Intergenic
971860089 4:32090747-32090769 CAGGAGCTGCAGGCTGGAGCAGG - Intergenic
976569704 4:86594260-86594282 CAGGACCGGGGGGGCGGAGCCGG + Intergenic
976729190 4:88245058-88245080 CAGGAGCCCCGAGCTGAAGCAGG + Intergenic
979136672 4:117118772-117118794 CAGGAGCCATGGGCTGGAGCAGG - Intergenic
979724333 4:123942453-123942475 CAGGAGCTGCTGGCCAGAGAGGG + Intergenic
980481610 4:133395167-133395189 CTGGAGCCACGGGCTGGAGAGGG + Intergenic
982494814 4:156077571-156077593 CAGGAGCCACAGGCCGGAGTGGG - Intergenic
983352023 4:166602215-166602237 CCAGAGCCGTGGGCCAGAGCAGG + Intergenic
985068357 4:186144734-186144756 CCGGGGCCGGGGCCCGGAGCGGG + Intronic
985070702 4:186164431-186164453 CAGGAGCCGAGCTCAGGAGCGGG + Intronic
985551387 5:535199-535221 CAGGGGCCGGGGGCAGGAGGCGG - Intergenic
985760259 5:1745296-1745318 CACGAGCCCCGGGCCTGGGCAGG - Intergenic
985784471 5:1886717-1886739 CAGGGTGCGCGGGCCGGCGCGGG - Intronic
985896392 5:2751919-2751941 CGCGAGCCGCGGGCTGGGGCCGG - Intergenic
986652588 5:9979401-9979423 CAGGATCCAAGGGCAGGAGCAGG - Intergenic
987441925 5:17967215-17967237 CAGGAGCCATGGGTTGGAGCAGG - Intergenic
990165490 5:52989273-52989295 CAGGAGGGGCGGGCTGGGGCGGG + Intergenic
992939943 5:81751507-81751529 CTGGAGTCTCCGGCCGGAGCCGG + Intronic
994239625 5:97406166-97406188 CAGGAGCCATGGACCGAAGCAGG - Intergenic
994948178 5:106423313-106423335 CAGGAGCCACTGGCCAGAGCAGG + Intergenic
996176843 5:120369150-120369172 CAGGTGCTGCTGGCCAGAGCAGG + Intergenic
996217450 5:120887052-120887074 CAGGAGCTGTGGGCCAGAGTGGG - Intergenic
996542126 5:124641322-124641344 CAGGTGCCGCTGGCCGAAGGGGG + Exonic
1001035256 5:168292331-168292353 CTGGAGCCGCCGGCCGGGACTGG + Intronic
1001330341 5:170757905-170757927 CAGCAGCCGAGAGCCAGAGCAGG + Intergenic
1001401974 5:171451216-171451238 GAGGCGCCGGGGGCCGGGGCCGG - Intronic
1001462048 5:171924694-171924716 CAGGAGCCGTGGGCCAGAGCAGG + Intronic
1001600542 5:172925538-172925560 CAGGAGCAGTGGGCAGCAGCGGG - Intronic
1001628177 5:173154424-173154446 CAGAAGCCGCTGGCGGGGGCAGG - Intronic
1002131833 5:177086822-177086844 AAGGAGGGGCGGGCCCGAGCAGG + Intergenic
1002418728 5:179134735-179134757 CTGGAGCCGGGAGCTGGAGCTGG - Intronic
1002418744 5:179134787-179134809 CGGGAGCTGGGGGCTGGAGCCGG - Intronic
1002418752 5:179134807-179134829 CGGGAGCTGGGGGCTGGAGCCGG - Intronic
1002418760 5:179134827-179134849 CGGGAGCTGGGGGCTGGAGCCGG - Intronic
1002418786 5:179134900-179134922 CGGGAGCTGGGGGCTGGAGCCGG - Intronic
1002418794 5:179134920-179134942 CGGGAGCTGGGGGCTGGAGCCGG - Intronic
1002418803 5:179134946-179134968 CTGGAGCCGGGAGCTGGAGCTGG - Intronic
1002418806 5:179134959-179134981 CCGGAGCTGGGGGCTGGAGCCGG - Intronic
1002418830 5:179135026-179135048 CGGGAGCTGGGGGCTGGAGCTGG - Intronic
1002418849 5:179135079-179135101 CGGGAGCTGGGGGCTGGAGCCGG - Intronic
1002418857 5:179135099-179135121 CGGGAGCTGGGGGCTGGAGCCGG - Intronic
1002418871 5:179135139-179135161 CGGGAGCTGGGGGCTGGAGCCGG - Intronic
1002418880 5:179135165-179135187 CTGGAGCCGGGAGCTGGAGCTGG - Intronic
1002454041 5:179336171-179336193 CAGGAGGCGGGGGCCAGGGCCGG - Intronic
1002454525 5:179338611-179338633 CAGGCGACTCAGGCCGGAGCTGG + Intronic
1002540103 5:179900973-179900995 CGGGTGCCACGGGCTGGAGCAGG - Intronic
1002574071 5:180161659-180161681 CAGGAGCCGCGGGGCTGGGGAGG - Intronic
1002632706 5:180591617-180591639 CAGGGCCCGCCGGCCGCAGCAGG - Intergenic
1002664043 5:180810066-180810088 TAGGAGCCGCGGCCCGCCGCGGG + Intronic
1002777445 6:341115-341137 CAAGGACCGCGGGCAGGAGCGGG + Intronic
1003882564 6:10491641-10491663 GGAGAGCCGCGGGCGGGAGCCGG + Intergenic
1004272850 6:14210972-14210994 CAGGAGCCGCCTGCCGCAGGCGG - Intergenic
1004561924 6:16760405-16760427 CGGCAGCCGCCGCCCGGAGCCGG - Intronic
1006303886 6:33207834-33207856 CAGGAGCCGCGGCCCGGGGCGGG - Intergenic
1006455589 6:34130087-34130109 CAGGAGCCTCGGGAAGGAGAGGG - Intronic
1006516931 6:34550406-34550428 CAGGAGCTGCTGGCCCGAGGTGG - Intronic
1006554167 6:34851750-34851772 CAGGAGCCATGGCCCGGAGTCGG + Intronic
1006638491 6:35476344-35476366 CAGGAGCCGCAGCCGGGAGGAGG + Exonic
1007519464 6:42440356-42440378 CAGGTGCTGCGTGGCGGAGCTGG - Intronic
1007589610 6:43013486-43013508 CAGGAGCCTCGGGGAGGAGCTGG - Intronic
1008673364 6:53795178-53795200 GCGGAGCCGCCGGCCAGAGCGGG + Exonic
1009645572 6:66396368-66396390 CAGGAGCCGTGGGCCTGAGGAGG + Intergenic
1010044179 6:71420870-71420892 CTGGAGCCAGGGGGCGGAGCGGG - Intergenic
1010489036 6:76452479-76452501 CTGGAGCCGCGGGCTGGAGTGGG - Intergenic
1010569821 6:77463417-77463439 CAAGAGCTGCGCTCCGGAGCTGG - Exonic
1011603594 6:89081389-89081411 CGGGAGCCGCGGGCCGCAGCGGG - Exonic
1012316840 6:97791390-97791412 CAGGAGCCATGGGCTGGAGTGGG - Intergenic
1014724878 6:124962331-124962353 GAGGAGCGGCGGGCCGGGCCAGG + Intergenic
1014817682 6:125953284-125953306 CAGGAGTCATGGGCCAGAGCAGG + Intergenic
1017372928 6:153735103-153735125 CAGGAGCTGGGGGATGGAGCAGG - Intergenic
1017396195 6:154002520-154002542 CAGGAGCCACGGGCTGGAGTCGG - Intergenic
1018109433 6:160520626-160520648 CGAGAGGCGCGGGCGGGAGCCGG - Intergenic
1018159185 6:161021317-161021339 CAGAAGCAGCAGGCAGGAGCAGG - Intronic
1018652900 6:166006139-166006161 CAGCAGCCGCGGGCGGGCGGGGG - Intergenic
1019617991 7:1975207-1975229 CAGGAGCCCAGGGCAGGACCTGG - Intronic
1020130499 7:5556335-5556357 CAGGGGCCGCGGGCCGGGGGCGG - Intronic
1021015422 7:15525753-15525775 CAGGAGCCCCAGGCTGGAGAGGG + Intronic
1021716984 7:23469743-23469765 GCAGAGCCGCGGGCCGGAGTGGG + Intronic
1022020939 7:26398807-26398829 CGGGACCAGCGGGCGGGAGCAGG - Intergenic
1023224756 7:37957795-37957817 AAGTAGCCGCAGGCCAGAGCAGG + Intronic
1023866222 7:44239540-44239562 CAGGAGGGACGGGCGGGAGCGGG + Intronic
1023934539 7:44730099-44730121 CTGGAGCCACGGGCCAGAGTGGG + Intergenic
1024612694 7:51081079-51081101 CAGGAGCGCGGGGCAGGAGCGGG + Intronic
1026867307 7:73831707-73831729 AAGGAGCAGCAGGCCGGAGGCGG - Exonic
1028998783 7:97130561-97130583 CAAGAGCCACAGGCCAGAGCAGG - Intronic
1029392957 7:100287707-100287729 CAGGAGCCGGTGGCCAGAGCTGG - Intergenic
1029414760 7:100435937-100435959 CTGGAGCTGCGGGCCGCAGCCGG - Exonic
1029732415 7:102447051-102447073 GAGGGGCCGAGGGCCGGGGCTGG + Exonic
1031196933 7:118627384-118627406 CAGGAGCTGCAGGCTAGAGCTGG + Intergenic
1033275272 7:139967066-139967088 CAGGAGCTGGTGGCAGGAGCTGG - Intronic
1034215825 7:149404927-149404949 CAGGAGCTTCAGGCCAGAGCGGG - Intergenic
1034349681 7:150407777-150407799 CAGAAGGCGCACGCCGGAGCGGG + Intronic
1034418770 7:150978340-150978362 CGGGAGGCGGGGGCCGGAGCCGG - Intergenic
1034447133 7:151119541-151119563 CAGGAGGCGGGAGCCGGAGGTGG - Intronic
1035127172 7:156616849-156616871 GACGGGCCGCGGGCAGGAGCGGG - Intergenic
1035237519 7:157508561-157508583 CAGGAGGCGTGGGCCTGGGCAGG - Intergenic
1036950336 8:13133548-13133570 GAGGAGGCGCGGGGCGGGGCGGG - Intronic
1037116878 8:15237508-15237530 GAGGAGCCGCGGGAAGGAGAGGG + Intronic
1037788931 8:21919793-21919815 GAGGAGCCGCGGGGGGGAGGGGG + Intronic
1037901415 8:22691527-22691549 TGGGCGCCGCGGCCCGGAGCCGG - Intronic
1039554780 8:38468053-38468075 CGGGGGCGGCGGGCCGGAGCCGG - Intronic
1040408743 8:47134147-47134169 CAGGTGCTGAGGGTCGGAGCTGG - Intergenic
1041151930 8:54944172-54944194 CAGGAGCCATGGGCTGGAGCAGG - Intergenic
1042190060 8:66177381-66177403 CCTGAGCCGCGGGCCGGTCCCGG - Exonic
1043769956 8:84184908-84184930 CAGGCCACGCGAGCCGGAGCTGG + Exonic
1044302916 8:90606456-90606478 CGGGAGGCGCGGGCGGGAGCCGG - Intergenic
1045277579 8:100721647-100721669 CCGGGGCTGGGGGCCGGAGCCGG + Exonic
1047100157 8:121667526-121667548 CAGGAGCCCCCGGCGGGGGCGGG + Intergenic
1047454803 8:124998872-124998894 CGGGGGCTGCGGGCCGGCGCGGG - Exonic
1048468740 8:134688629-134688651 CAGGAGCCCTGGGAGGGAGCAGG + Intronic
1049109890 8:140635872-140635894 TGGGAACCGCGGGCGGGAGCGGG + Intergenic
1049467391 8:142757872-142757894 TAGGAGCAGCGGGTAGGAGCAGG + Intergenic
1049614329 8:143569494-143569516 CAGGCGCCCGGGGCCGCAGCAGG + Exonic
1049649928 8:143761155-143761177 CCGGAGCCGCGCGCCCGAGAAGG + Intergenic
1049655610 8:143795633-143795655 CAGGAGCCGCGTCCCTGGGCAGG + Intronic
1049747745 8:144270138-144270160 CAGGGGCTGCTGGCCTGAGCGGG + Intronic
1049850335 8:144827217-144827239 CTGGGGACGCGGGCCGGGGCCGG - Intergenic
1049985632 9:948221-948243 GAGGAGGGGCGGGCCTGAGCAGG - Intronic
1054175050 9:61869176-61869198 CCGGGGCCGGGGGCCGGGGCCGG + Intergenic
1054662487 9:67711617-67711639 CCGGGGCCGGGGGCCGGGGCCGG - Intergenic
1057918049 9:99072602-99072624 CAGGAGCAGAGGGTCTGAGCAGG + Intergenic
1059414987 9:114156736-114156758 CAGGAGCGGCTGCGCGGAGCTGG + Intronic
1059438520 9:114290083-114290105 CAGGGGCCCCAGGCCGGAGGGGG + Exonic
1059769856 9:117414888-117414910 CCGGAGCCCCGAGCCGGGGCCGG + Exonic
1060530034 9:124342594-124342616 CAGGAGCCTCGTGCCGGAGGCGG - Intronic
1060810846 9:126610839-126610861 CAGGGGCCGAGGCCCAGAGCCGG - Intergenic
1061044231 9:128155944-128155966 CTGGAGCCACAGGCCAGAGCAGG + Intergenic
1061151282 9:128829648-128829670 CAGGAGGCGCGGCCCGGCCCCGG + Intronic
1061348157 9:130043095-130043117 GAGGAGCTGCGAGCCGGAGGAGG - Exonic
1061666145 9:132161988-132162010 CCGGAGACGCGGGCCGGGGGAGG - Exonic
1062035358 9:134380362-134380384 CAGGAGCCAGGGGCCAGATCAGG + Intronic
1062112957 9:134792099-134792121 GAGGAGCCGGGGGCCGGCACAGG + Intronic
1062231444 9:135484219-135484241 CAGCAGCCCCGGGCTGGAGCAGG + Intronic
1062390573 9:136332089-136332111 CAGCAGCAGCGGGCGGGGGCGGG - Intronic
1062443847 9:136585182-136585204 GAGGAGCCGTGGGGAGGAGCAGG + Intergenic
1062544165 9:137054235-137054257 CGGGAGCCGGGGGGCGGTGCTGG - Intergenic
1062591940 9:137278259-137278281 TGGGAGCCGCGGGCGGGGGCAGG + Intronic
1062635109 9:137486612-137486634 TAGGAGCCTGGGGCCGGAGGTGG - Intronic
1062707449 9:137953338-137953360 TCGGAGCCGTGGGCCTGAGCAGG - Intronic
1203460401 Un_GL000220v1:31106-31128 CAGGAGCCCTTGGCCGGAGTGGG + Intergenic
1185508228 X:644318-644340 CCGGGGGCGCGGGGCGGAGCAGG + Intronic
1188006742 X:25020946-25020968 CAGGCCGCGCGGACCGGAGCTGG + Intergenic
1190056866 X:47186199-47186221 CTGGAGCCCGGGGCCGGGGCCGG + Intronic
1192247962 X:69388853-69388875 CAGGATGAGCGGGCTGGAGCTGG + Intergenic
1198047017 X:132913310-132913332 CTGGGGCTGCGGGCTGGAGCAGG + Intronic
1199798668 X:151227905-151227927 AAGAAGCGGCGGGCCCGAGCTGG - Intergenic
1199832903 X:151562742-151562764 CAGGAGCCGACGGCCGGGGCAGG + Intergenic
1200098142 X:153673711-153673733 CGGCGGCCGCGGGCCGGATCCGG + Intronic
1200231024 X:154443982-154444004 CAGGAGCCGGCGGCGGGGGCTGG + Intergenic