ID: 935648911

View in Genome Browser
Species Human (GRCh38)
Location 2:105365490-105365512
Sequence AACTCAGATGAACTTCCGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 80}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935648911 Original CRISPR AACTCAGATGAACTTCCGTT AGG Intronic
900854428 1:5169583-5169605 AATTCATATGAGCTTCCCTTTGG - Intergenic
909842478 1:80345982-80346004 AACTCAAATAAACTTTCTTTTGG - Intergenic
915258882 1:154660709-154660731 ACCTCAGGTGATCTTCCCTTTGG - Intergenic
916775545 1:167959930-167959952 AACTCAGATGACCTTGGGTATGG - Intronic
920875912 1:209835437-209835459 AAAGCAGATGAACTTGCCTTGGG - Intronic
921608066 1:217178302-217178324 ATCTCAAATGAACTTCTGTGTGG - Intergenic
924246097 1:242086674-242086696 AATTCAAATGACCTTCCGATGGG - Exonic
1065341012 10:24705066-24705088 AACTCAAATTAAATTCCTTTGGG + Intronic
1065861442 10:29875769-29875791 AAATCACAAGAACTTCCTTTAGG + Intergenic
1068653166 10:59545685-59545707 AACTCCAATGAACTTCAGTTTGG - Intergenic
1069077718 10:64055579-64055601 AATTGAGTTGAACTTCCTTTAGG - Intergenic
1070337913 10:75471268-75471290 AACACAGATGAACTTCCTGAAGG - Intronic
1072827356 10:98620784-98620806 AAATCAGATCAACTTCCTTAAGG - Intronic
1080160959 11:29175651-29175673 AACTCAGATAAATTTGAGTTTGG + Intergenic
1086565084 11:88216619-88216641 AAGTCAGTTGACCTTCTGTTTGG + Intergenic
1087706207 11:101495234-101495256 AACTAAGAGGAACTTCCGAAAGG - Intronic
1088311976 11:108469847-108469869 AACTCAGAAGAACTTCTGGGTGG + Intergenic
1088460108 11:110073968-110073990 AACTCAGATGAATTTGACTTTGG - Intergenic
1094298981 12:28939700-28939722 AACTCAGGAAAATTTCCGTTTGG + Intergenic
1096504160 12:52082217-52082239 AAGGCTGATGACCTTCCGTTTGG + Intergenic
1104241090 12:126990253-126990275 AGCTCAGAGGAACTTCCCCTAGG - Intergenic
1106783668 13:33086246-33086268 CACTGAGATGAACTTTCTTTTGG + Intergenic
1116218109 14:42046599-42046621 AAATTAGATGACCTTCTGTTTGG - Intergenic
1116506047 14:45682679-45682701 AAGTCAGATCAACTGCTGTTTGG - Intergenic
1127900845 15:63339735-63339757 AACTCAGATGACCTAACTTTGGG + Intronic
1131573152 15:93559621-93559643 TACTCAGAGGAACTTCCAATCGG + Intergenic
1134875998 16:17699245-17699267 AACTCAGATGTCCTTCAGTGGGG - Intergenic
1136858893 16:33683403-33683425 AAATCAGATAAACTTTGGTTGGG - Intergenic
1141123639 16:81383860-81383882 AAGACAGATGAACCTCCGTTTGG - Exonic
1203120465 16_KI270728v1_random:1531897-1531919 AAATCAGATAAACTTTGGTTGGG - Intergenic
1144052580 17:11509625-11509647 AACTCAAAAGACCTTCAGTTAGG - Intronic
1147639366 17:41985487-41985509 AACCCTGATGAACTTTCTTTAGG + Intronic
1150965365 17:69961766-69961788 AACCCAGTTGAACTTGCCTTGGG - Intergenic
1151498530 17:74474138-74474160 CACTCAGCTGCACTTCCGTTGGG - Intronic
1156851251 18:41729395-41729417 AATTCAAATGAACTCCCATTAGG + Intergenic
1158836657 18:61336938-61336960 AACTAAGAAGAACTGCCCTTTGG - Intronic
1165038262 19:33050068-33050090 AAGTCAGATGTTCTTCCCTTTGG - Intronic
925097411 2:1218251-1218273 AACTCAGCTGACCTTGAGTTAGG - Intronic
925390088 2:3488609-3488631 AACTCAGATGAAATCCTATTTGG + Intergenic
925390094 2:3488654-3488676 AACTCAGATGAAATCCTATTTGG + Intergenic
925390100 2:3488699-3488721 AACTCAGATGAAATCCTATTTGG + Intergenic
926300673 2:11599873-11599895 AACCCAGATGAATTTCAGATGGG + Intronic
928574725 2:32643236-32643258 AACTCAGATCAACTTACTTAGGG - Intronic
930445204 2:51462196-51462218 AACTCAGGTGAAATTCCAGTTGG - Intergenic
931339891 2:61390341-61390363 AAGTGAGATTAACTTCCATTTGG + Intronic
932966583 2:76482600-76482622 AACTCAGAAGAACTTGCTCTAGG + Intergenic
933052568 2:77618008-77618030 ATGTCAGATGAACATCGGTTCGG - Intergenic
935648911 2:105365490-105365512 AACTCAGATGAACTTCCGTTAGG + Intronic
936941706 2:117890587-117890609 AACCCTTATGAACTTCAGTTGGG - Intergenic
939998637 2:148944765-148944787 AACTCTGATGTACTGCTGTTAGG - Intronic
943905643 2:193497967-193497989 AAATCAGATTTACTTCCATTTGG + Intergenic
1178691057 21:34750335-34750357 AACTCACATGCACTTCTGGTGGG - Intergenic
1180411761 22:12618211-12618233 AATTCAGATGAACTTCTTATTGG + Intergenic
952892439 3:38052666-38052688 ATCTCAGATAAACTTCCCTCTGG - Intronic
957929196 3:86856365-86856387 AAAAAAGATGAACTTCCTTTAGG + Intergenic
963223717 3:142839125-142839147 AACTCAGATCAACTCTAGTTAGG + Intronic
963326898 3:143873444-143873466 AACTTAGATGAACTTTTGTAGGG + Intergenic
967003377 3:185358966-185358988 GACTTGGATGAACTTCCCTTTGG + Intronic
968931827 4:3584510-3584532 AAATCAGCTGACCTTCAGTTAGG + Intronic
970374446 4:15442471-15442493 AGCACAGATGAACTTCCCTGTGG - Exonic
970486984 4:16534766-16534788 GATTCAGATGAACTTCTGTAGGG + Intronic
972918765 4:43911164-43911186 TACTCAGATTAACTTCTGTATGG + Intergenic
975743672 4:77454799-77454821 ATCCCAGATGAATTTCAGTTGGG + Intergenic
979517574 4:121628111-121628133 AACTCAGATGCAGTCCCTTTAGG - Intergenic
993899712 5:93576717-93576739 AACTCAGATCTACTTCTGATGGG + Intergenic
995991033 5:118240011-118240033 AACACAGATGAAGTTTCATTTGG - Intergenic
995992725 5:118262554-118262576 AATTCAGATGAGCATCCTTTGGG - Intergenic
999856706 5:155602680-155602702 AACTCAGTTCAACTGCCTTTAGG + Intergenic
1006414219 6:33893846-33893868 AACACTGATGAACTCCAGTTGGG + Intergenic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1012979950 6:105818745-105818767 AACCCAGGTGATCTTCTGTTTGG - Intergenic
1014231725 6:118910908-118910930 GAGTCAGATTAACTTCCATTGGG - Intronic
1017776225 6:157682963-157682985 ATCTCAGCTGAAATTCCGATAGG - Intergenic
1041951125 8:63503897-63503919 AACTTAGATGACCTTCGGTATGG - Intergenic
1042893625 8:73641815-73641837 AAATCAGATAAACATCCCTTTGG + Intronic
1043728154 8:83639202-83639224 AACTCAGTTGAACTTCCTTATGG - Intergenic
1044588528 8:93890866-93890888 AACACAGATGACCTTCACTTTGG + Intronic
1045367810 8:101493173-101493195 AACTCAGCTGAACTTCCAAATGG - Intronic
1046224737 8:111262879-111262901 AACTCAGATTTCCTTCTGTTAGG - Intergenic
1048090996 8:131239999-131240021 ATCTCAAATGCACTTCCTTTAGG - Intergenic
1054458302 9:65447419-65447441 AAATCAGCTGACCTTCAGTTAGG - Intergenic
1056690097 9:88800765-88800787 AAATTATATGAACTTCAGTTTGG + Intergenic
1195176002 X:102316044-102316066 GCCTCAGATGAACTTCTGTAGGG - Intronic
1195182862 X:102371049-102371071 GCCTCAGATGAACTTCTGTAGGG + Intronic
1199506784 X:148571417-148571439 AACCCAGATGAGCTGCAGTTGGG - Intronic