ID: 935649749

View in Genome Browser
Species Human (GRCh38)
Location 2:105372129-105372151
Sequence TATTAACCAGAGAAATGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 230}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935649746_935649749 28 Left 935649746 2:105372078-105372100 CCTGGGCATTTTTCTTCCCTGTC 0: 1
1: 0
2: 9
3: 45
4: 348
Right 935649749 2:105372129-105372151 TATTAACCAGAGAAATGTAGTGG 0: 1
1: 0
2: 1
3: 26
4: 230
935649748_935649749 11 Left 935649748 2:105372095-105372117 CCTGTCATAGTGTGTCACAGTTG 0: 1
1: 0
2: 0
3: 17
4: 246
Right 935649749 2:105372129-105372151 TATTAACCAGAGAAATGTAGTGG 0: 1
1: 0
2: 1
3: 26
4: 230
935649747_935649749 12 Left 935649747 2:105372094-105372116 CCCTGTCATAGTGTGTCACAGTT 0: 1
1: 0
2: 0
3: 15
4: 149
Right 935649749 2:105372129-105372151 TATTAACCAGAGAAATGTAGTGG 0: 1
1: 0
2: 1
3: 26
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935649749 Original CRISPR TATTAACCAGAGAAATGTAG TGG Intronic
907804862 1:57808271-57808293 AGTTAACCAGAGAAAACTAGAGG - Intronic
909395209 1:75164012-75164034 TATGAACAACAGAAATGTATTGG - Intergenic
911048232 1:93646925-93646947 CATTAATCAGATAAATGTAATGG + Intronic
911139090 1:94478548-94478570 TAAAAACCAGACAAATGTATTGG + Intronic
911454937 1:98110936-98110958 TATTTATGAGAGAAATGTTGTGG + Intergenic
912580650 1:110718094-110718116 TATTAAGAAGAGAAACCTAGCGG - Intergenic
913553338 1:119938315-119938337 TTTTAACCAGAAATAAGTAGAGG - Intronic
914319971 1:146549708-146549730 TATAAACCTGAGAAATGTGAAGG - Intergenic
916287067 1:163119667-163119689 TATTACCCAAAGCAATTTAGAGG + Intronic
916640861 1:166727681-166727703 TATTAACCAAAGACATGTAGTGG + Intergenic
918151584 1:181801694-181801716 AATTAACCAGAGAAAAGAATAGG - Intronic
919340039 1:196293748-196293770 TATTGCCCAGAGCAATGTTGTGG - Intronic
920630519 1:207647172-207647194 TATTAACCAGGGAAGTGTTCTGG + Intronic
922088759 1:222375858-222375880 TTTTAACCAGAAAAATGATGTGG - Intergenic
922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG + Intronic
923116347 1:230942216-230942238 CATAAACCAGAGTAATATAGGGG + Intronic
1065433554 10:25684042-25684064 TATTACAAAGAGAAATGTATTGG + Intergenic
1065477453 10:26155711-26155733 TATTAAGCATATAAATGTACTGG - Intronic
1066957968 10:42190782-42190804 TATTAGCCAGTGACATCTAGAGG + Intergenic
1067255733 10:44638040-44638062 TATTTACCAGAAAATTGCAGAGG + Intergenic
1068869752 10:61930216-61930238 AATAAAGCAAAGAAATGTAGAGG + Intronic
1070387329 10:75937608-75937630 TTTAAACCATAGAAATGAAGGGG + Intronic
1071988929 10:91080848-91080870 AAGTCACCAGGGAAATGTAGGGG - Intergenic
1073459512 10:103658564-103658586 GCCTAACCAGAGAAATGAAGTGG - Intronic
1073961526 10:108935603-108935625 TATTGACCAAACAAATGGAGTGG + Intergenic
1075216023 10:120536107-120536129 TATTATCCAAAGCAATCTAGAGG + Intronic
1076332412 10:129680094-129680116 TATGAACGAGAGGAATGTATGGG - Intronic
1078705844 11:13743113-13743135 TATTAGCCAAATAAATTTAGTGG - Intergenic
1079948465 11:26771872-26771894 TTTTAAGCAGAGACCTGTAGAGG - Intergenic
1081140664 11:39494722-39494744 TATACTCAAGAGAAATGTAGTGG + Intergenic
1081221364 11:40467235-40467257 TTTTAAACAGAGAAAAGAAGTGG - Intronic
1081885801 11:46495084-46495106 TAGGAAGCAGTGAAATGTAGTGG - Intronic
1084995363 11:72972109-72972131 TATTAACGAGAGTATTGTATAGG - Intronic
1086560951 11:88168580-88168602 TGATAAGCAGAGAAATTTAGGGG - Intronic
1088052174 11:105530272-105530294 TGCTAAACAGAGAAATCTAGAGG - Intergenic
1088291656 11:108245122-108245144 TATCAACCAGAGAAATCCAGAGG - Intronic
1088530251 11:110800242-110800264 TATTGACCTGAGAAATGCAAGGG - Intergenic
1088941279 11:114459630-114459652 TATTAAACAGAAAGATGTTGTGG + Intergenic
1089943877 11:122447178-122447200 TATTAACCAGGGAAAAGCACTGG + Intergenic
1090255802 11:125283282-125283304 TATTAAACAGGGAAATGAATGGG + Intronic
1090341658 11:126027547-126027569 TATTTGCCAGAGCAATGTAGGGG - Intronic
1095307722 12:40657930-40657952 TTTTAACCAGAGAAAGGTACAGG - Intergenic
1097497522 12:60359229-60359251 TATAAACCAGAAAAATGTCTAGG - Intergenic
1097921601 12:65080554-65080576 TATTATCTAGTAAAATGTAGAGG - Intronic
1098423508 12:70331162-70331184 TTTTAAATGGAGAAATGTAGGGG + Intronic
1098608332 12:72422136-72422158 TTTTATCTATAGAAATGTAGTGG + Intronic
1099279397 12:80624612-80624634 CATTAACCAGAGAAATGGCTGGG - Intronic
1099381107 12:81953883-81953905 TATGAACCAGAGAAATTTCAAGG - Intergenic
1103859232 12:123998717-123998739 TGTAAACCACAGAAATGCAGAGG + Intronic
1104509480 12:129364121-129364143 GAATAAGCAGTGAAATGTAGTGG + Intronic
1106029028 13:25982556-25982578 GATAACCCAGAGAAATGCAGTGG + Intronic
1106357107 13:28993582-28993604 TTTTATCTAGAGAAAGGTAGGGG + Intronic
1107817672 13:44258629-44258651 TATAAACAACAGAAATGTATTGG - Intergenic
1108482328 13:50886635-50886657 TAATAACAAGGGAAATTTAGGGG + Intergenic
1108773600 13:53735364-53735386 TATGAATTAGAAAAATGTAGTGG + Intergenic
1109688987 13:65861284-65861306 AATTAAATAGAGAAATGAAGGGG + Intergenic
1110044361 13:70810200-70810222 TATCTACCAGATAAATGTGGAGG + Intergenic
1110616801 13:77550849-77550871 TTTTAACCAAAGGAATGTTGGGG + Intronic
1110694444 13:78471735-78471757 TATTAAACAGAGAATAGCAGAGG + Intergenic
1113877764 13:113605424-113605446 TGTGAAACAGACAAATGTAGTGG + Intronic
1115363554 14:32531155-32531177 AATTAAACAAAGCAATGTAGAGG + Intronic
1116088486 14:40273388-40273410 TGTTGACCAGAGAAATCTACAGG + Intergenic
1116341381 14:43727234-43727256 TATGAACAAGAGAAAGGAAGAGG - Intergenic
1118920617 14:70146344-70146366 TACTAACAGGTGAAATGTAGTGG - Intronic
1120589427 14:86357803-86357825 TATTTTCCAGAGAAATTAAGGGG - Intergenic
1120607775 14:86600822-86600844 TGTTAAACAGAGAAATGTAAAGG - Intergenic
1120722886 14:87906803-87906825 TATTACCCAGTGAAATGTCATGG - Intronic
1122981640 14:105194840-105194862 TATGAACCAGAGAAGTGGGGAGG - Intergenic
1124480725 15:30076998-30077020 TATTAACAACAAAAATGTGGTGG - Intergenic
1125092805 15:35814111-35814133 TAGTCATCAGAGAAAGGTAGAGG + Intergenic
1125368064 15:38940404-38940426 TTTTAAACTGAGAACTGTAGAGG - Intergenic
1130415469 15:83690494-83690516 AATTAGCCAGAAAAATGGAGAGG - Intronic
1130563325 15:84975769-84975791 TAGTAACCACAGACATGTTGAGG + Intergenic
1130906409 15:88243651-88243673 TGTTTACCTGGGAAATGTAGGGG - Intronic
1131004310 15:88964233-88964255 TACTAACCAAAGCAATCTAGAGG - Intergenic
1131450311 15:92533881-92533903 AATTCACTAGAGAAAAGTAGTGG - Intergenic
1131848356 15:96511999-96512021 AATTAACCAGAGAACTGGAAAGG + Intergenic
1132636912 16:954370-954392 CATTAACCAGGGACATGTAGAGG + Exonic
1135402963 16:22178777-22178799 AATTAACCAAGGAAATGAAGTGG + Intronic
1139276139 16:65729262-65729284 TATAAACCACAGAGATGTACTGG + Intergenic
1140013555 16:71160369-71160391 TATAAACCTGAGAAATGTGAAGG + Intronic
1140901779 16:79374432-79374454 AATTCAGGAGAGAAATGTAGGGG - Intergenic
1143414984 17:6740439-6740461 TATAAACCTGAGAAATGCATGGG + Intergenic
1144369222 17:14574093-14574115 TGTTAACCAGGTAAATGAAGAGG - Intergenic
1145715456 17:27015513-27015535 TAAAAACCAGAGAAATGGAATGG + Intergenic
1145774114 17:27514946-27514968 TTCTAACCAGTGAAATGTAAGGG - Intronic
1150515266 17:65802331-65802353 TATTGCCCAGAGAAATTTTGTGG - Intronic
1155307514 18:24492916-24492938 TATTTATAAGAGAAATCTAGGGG + Intergenic
1155588092 18:27391127-27391149 TAATAACTAGAGTAATGTGGAGG + Intergenic
1155660862 18:28246866-28246888 TGTTCACCAGAGAAAGGAAGTGG + Intergenic
1156028899 18:32689941-32689963 CATTGACCACAGAAATTTAGTGG + Intronic
1156914762 18:42452709-42452731 AGTAAACCAGAGAAATGTGGTGG + Intergenic
1159438482 18:68447688-68447710 TATTAACCTGGGGAATGTAGTGG - Intergenic
1164103578 19:22082113-22082135 TATTAATAACAAAAATGTAGAGG - Intronic
1165185621 19:34018427-34018449 TATGAAACAGAGATATTTAGTGG - Intergenic
1166514880 19:43438874-43438896 TATAAGCCAGGGAAATTTAGTGG - Intergenic
1166925471 19:46264078-46264100 CATTAACCAGGGCAATCTAGTGG - Intergenic
925737293 2:6974764-6974786 AATTAAGAAGAGACATGTAGGGG + Intronic
926381967 2:12299969-12299991 TTTCAACCTGAGAATTGTAGGGG + Intergenic
928570047 2:32597809-32597831 TTTTCACCTGAGACATGTAGTGG - Exonic
930292258 2:49510017-49510039 TTTTGACCAGAGAAATTCAGTGG + Intergenic
930600637 2:53439013-53439035 CATAAACCATAGAAATGTAAGGG + Intergenic
931102860 2:59021807-59021829 TATTAACAAAAGAAATGAGGAGG - Intergenic
931147472 2:59534896-59534918 TATGAGCCAGAGACATGGAGAGG - Intergenic
931487949 2:62712396-62712418 AATTGACTAGGGAAATGTAGGGG + Intronic
932864547 2:75327895-75327917 TATCATCTAGAGAATTGTAGGGG + Intergenic
933133801 2:78706173-78706195 TATTAACCAGAGATATGCTGTGG + Intergenic
933158767 2:79001875-79001897 TAATAACCAGAGGAAGGTAGGGG - Intergenic
935424353 2:102904520-102904542 TATTGACCAGGTAAATGTATGGG - Intergenic
935649749 2:105372129-105372151 TATTAACCAGAGAAATGTAGTGG + Intronic
937052692 2:118905306-118905328 CTTTAACCAATGAAATGTAGGGG - Intergenic
937125743 2:119474088-119474110 TATTATGCAGAGAAATGCAGAGG - Intronic
939350127 2:141025978-141026000 TATTATCCAAAGAATTTTAGTGG - Intronic
939672487 2:145030219-145030241 TTTTAACCAGGGAACTGGAGGGG + Intergenic
940133496 2:150410311-150410333 GATTAACCAGAGAAACATGGAGG - Intergenic
940187355 2:151002085-151002107 TATTAAATAGAGGAATCTAGTGG - Intronic
942087167 2:172454343-172454365 TTTTAAGCAGAGACATGAAGGGG + Intronic
942480641 2:176384635-176384657 TATTATCCAGTGAATTGAAGGGG + Intergenic
943582085 2:189696466-189696488 TATTAACTAGAGCAAAGTTGAGG + Intronic
944870237 2:203903824-203903846 TATGAACTAGAAAAATGTTGTGG + Intergenic
945326659 2:208490025-208490047 TTTTAAAAAGAGTAATGTAGTGG - Intronic
946250252 2:218406966-218406988 TTTTTACCAGAGAAAAGTAGTGG - Intergenic
946534608 2:220612699-220612721 GATAAACCAAAGAAATGTTGAGG - Intergenic
946988261 2:225299449-225299471 TTTTAACCATAGAAATGCGGTGG + Intergenic
947047847 2:226008608-226008630 TACTAAGAAGAGAAATCTAGGGG - Intergenic
948083214 2:235224761-235224783 TACTCACCAAAGAAATGTGGTGG - Intergenic
948166223 2:235864686-235864708 TATTAACTAGAAAAATCAAGAGG + Intronic
948423590 2:237874973-237874995 GATTCACCAGAGAAAGGCAGTGG + Intronic
948456809 2:238108338-238108360 TATTACCCAGATAAATCTTGGGG + Intronic
1170229970 20:14035767-14035789 AATTATTCAGAGAAATGGAGGGG + Intronic
1173634741 20:44545364-44545386 TGTTAACCAATGAAATGTAAAGG + Intronic
1174513003 20:51069644-51069666 TATTAGTCAGAGGAATGAAGAGG - Intergenic
1174985279 20:55444637-55444659 TAATAACAAGAGTAATGAAGAGG + Intergenic
1177297979 21:19201871-19201893 AATGGACCAGAGAAATGAAGAGG - Intergenic
1178576711 21:33799235-33799257 TATTTCCCAAAGAAATGTAGAGG + Intronic
1180279481 22:10680673-10680695 TATTAGCCAGTGACATCTAGAGG - Intergenic
1180586694 22:16899202-16899224 TATTAGCCAGTGACATCTAGAGG - Intergenic
1180590796 22:16935659-16935681 TATTAGCCAGTGACATCTAGAGG - Intergenic
950224256 3:11220778-11220800 TATAAAACAGAGAAATGCAGGGG - Intronic
953107397 3:39897493-39897515 TATAAACCAGAGAAATCAAGGGG + Intronic
954167346 3:48770591-48770613 AATTAACAGGAGAAAAGTAGAGG + Intronic
955232375 3:57110470-57110492 TCTTTACCAGAGGAATGCAGGGG - Intronic
957886622 3:86296710-86296732 TATTAAGAAGAGAAAAGTATTGG + Intergenic
958109374 3:89120543-89120565 TTTTAATCAGAGAAATATAAAGG - Intronic
959526754 3:107385934-107385956 AAATAACCAGGGAAATGCAGTGG + Intergenic
960206600 3:114908408-114908430 TAATAACCTGAGAAATTTAGGGG + Intronic
960250233 3:115443445-115443467 TTTTAACATGAGAATTGTAGAGG + Intergenic
960918518 3:122722579-122722601 TATGAACCAGATAAAAGCAGAGG + Intronic
961826551 3:129602201-129602223 TTTTAGCCAGAGAAGTGGAGTGG - Intronic
962208734 3:133458380-133458402 TCTTAACTAGAGAAAAGAAGAGG - Intronic
962889679 3:139660346-139660368 AATTAACAAGAGTAATGGAGTGG - Intronic
964078088 3:152716406-152716428 TATGGAGCAGAGCAATGTAGGGG - Intergenic
964159565 3:153630716-153630738 TATTCCCCAAAGAAATATAGAGG - Intergenic
964798003 3:160520864-160520886 TATTTACCTCAGAAAGGTAGAGG + Intronic
966505400 3:180695420-180695442 TATTAATCAGAGACATGTACAGG - Intronic
967013931 3:185464754-185464776 TATAAACAACAGAAATGTATTGG + Intronic
967033544 3:185630716-185630738 TATAAACCTCAGAATTGTAGGGG + Exonic
968014921 3:195320934-195320956 TATTAATAAGAAAAATGAAGGGG + Intronic
968160834 3:196425296-196425318 TATTAACCCAAGAAAGATAGTGG - Intronic
971639305 4:29109355-29109377 TATTAACCAATGAAAAATAGGGG + Intergenic
974264611 4:59568830-59568852 TATTTACAGGAGAAATTTAGAGG + Intergenic
974296749 4:60009943-60009965 TTTTAATCAGAGAAAAGCAGAGG - Intergenic
974754072 4:66180762-66180784 TATTTACCAAAAATATGTAGTGG - Intergenic
974948601 4:68559865-68559887 TCTTAAGCAGAAAAATGTAATGG - Intronic
974957630 4:68662333-68662355 TCTTAAGCAGAAAAATGTAATGG - Intronic
977556639 4:98493622-98493644 TATTAATAAGATATATGTAGAGG - Intronic
977887314 4:102267492-102267514 TATCTGCCAGAGAAATATAGAGG + Exonic
979550337 4:121983812-121983834 AATTATCCAGAGAACTGTATGGG - Intergenic
979774768 4:124576140-124576162 CATTCAACAGAGAAATATAGAGG + Intergenic
980012760 4:127615231-127615253 TATTGAACAGAAAAATGAAGTGG - Intergenic
981106797 4:140890959-140890981 AATTAATAAGAGAAATGAAGAGG + Intronic
982547472 4:156752704-156752726 TATTAACCAAGGGATTGTAGGGG - Intergenic
982872400 4:160598736-160598758 CATTAAACAGAGAATTATAGTGG + Intergenic
983234080 4:165159188-165159210 TATTAAACAGAAAAATGTACTGG + Intronic
983477041 4:168226238-168226260 TATTATCCAGAAGAGTGTAGTGG + Intronic
986397057 5:7341546-7341568 TCTTCAACAGAGAAGTGTAGGGG + Intergenic
988393791 5:30670110-30670132 TATTAGCCAGAGTTCTGTAGAGG - Intergenic
988419061 5:30983653-30983675 TATTAAGCACAGATATGTGGAGG - Intergenic
990485063 5:56250084-56250106 GAGGAAACAGAGAAATGTAGAGG - Intergenic
991592369 5:68266376-68266398 TAATAACCAGAGAAAGGCAGGGG - Intronic
993194888 5:84729263-84729285 TTTTAACCAAAGAACTGAAGAGG - Intergenic
993625239 5:90216206-90216228 TATTAACTAGAGAAAAGTAAAGG + Intergenic
995019318 5:107349055-107349077 TAGTTACCTGAGAAAGGTAGTGG - Intergenic
998576925 5:143326855-143326877 TATTAACTAGAAAAAAGTATAGG + Intronic
998653147 5:144143709-144143731 GATTAACCATAGTACTGTAGAGG + Intergenic
999871498 5:155756244-155756266 AACTATTCAGAGAAATGTAGGGG + Intergenic
1002453868 5:179334527-179334549 TATTAAGCAGAGAAATACCGGGG + Intronic
1005281098 6:24275231-24275253 AATTAAAGAGAGAAATGGAGAGG + Intronic
1009832755 6:68960001-68960023 TATTAACCAGGGGAATATTGGGG - Intronic
1010243699 6:73642337-73642359 TATTAAGCAGAAAACTGTAGTGG + Intronic
1012140297 6:95618502-95618524 TATTTACCAGAGAAGAGAAGGGG - Intergenic
1013897807 6:115112770-115112792 AATTACCAAAAGAAATGTAGCGG + Intergenic
1014700167 6:124676816-124676838 TATTAACCAAAAAAGTGTAGGGG - Intronic
1015618896 6:135108522-135108544 AATTCAACAGAGAAATATAGAGG + Intergenic
1016273301 6:142315988-142316010 TCTTAACCATAGAAATATGGTGG - Intronic
1016690050 6:146927277-146927299 TGTTCACTAGAGAAATGTAGAGG - Intergenic
1016948766 6:149560263-149560285 TATTCACAATAGAAATATAGAGG + Intergenic
1017471334 6:154739727-154739749 TATAGAACAGAAAAATGTAGTGG - Intronic
1018375735 6:163210641-163210663 TATTTAACAGAGAAATTTAGTGG - Intronic
1018753225 6:166825566-166825588 TTTAAACAACAGAAATGTAGTGG + Intronic
1019137349 6:169918618-169918640 TAACAGCCAGAGAAATGTTGAGG + Intergenic
1021616016 7:22504142-22504164 TATTAACCAGACAACTGTGTTGG + Intronic
1022925807 7:35055345-35055367 TATTAACCAGACAACTGTGTTGG + Intergenic
1023730594 7:43188198-43188220 CATTAACCAGAGTATTGTACAGG - Intronic
1025966491 7:66277804-66277826 AATAGACCATAGAAATGTAGAGG + Intronic
1027579404 7:79975531-79975553 TATAAACCAGAGAAAATGAGAGG - Intergenic
1028038861 7:86021361-86021383 TACTGAGTAGAGAAATGTAGTGG + Intergenic
1028376458 7:90150200-90150222 TATTAACCAGACAACTGTGTTGG - Intergenic
1029823813 7:103170038-103170060 TATTAACCAGACAACTGTGTTGG + Intergenic
1030151251 7:106407394-106407416 TATTTACCAGAGCTATGTAGAGG + Intergenic
1031362992 7:120869017-120869039 TATGAACCAAAGAAATGTCTCGG - Intergenic
1031524982 7:122813894-122813916 TGTTAACCAGAGAGATGTGAGGG + Intronic
1031890369 7:127287131-127287153 GATTAAGAAGACAAATGTAGAGG + Intergenic
1032311873 7:130795015-130795037 TATTTACAATAAAAATGTAGAGG + Intergenic
1037047795 8:14330760-14330782 TGCTTACCAGAGAAATGTAATGG + Intronic
1038724024 8:30063227-30063249 TATGAACGAAAGAAATATAGAGG + Exonic
1040676816 8:49760146-49760168 AATTCACCAGGGAAATGCAGAGG + Intergenic
1040699122 8:50039615-50039637 CATTAATTAGAGAAATGTATAGG - Intronic
1041989617 8:63970627-63970649 TTTTAACTTGAGAAATGTGGTGG - Intergenic
1043056950 8:75451409-75451431 TATTGCCCAGAGAAATGTCATGG + Intronic
1043799521 8:84589950-84589972 AATTACTCAGAGAAATGAAGAGG + Intronic
1045847304 8:106652945-106652967 TATAAATCAGAGAAATGAACAGG + Intronic
1046347707 8:112956494-112956516 TATAATGCAGAGAAAAGTAGAGG - Intronic
1047170731 8:122490030-122490052 TATTATCCAAGGAAATGTGGAGG + Intergenic
1047983461 8:130208033-130208055 TATCAAGGAGAGAAAAGTAGGGG - Intronic
1048721171 8:137327160-137327182 TCTTAACCAGAGACAGGAAGAGG - Intergenic
1050066581 9:1766202-1766224 TAGTTACCAGAGAAGAGTAGAGG - Intergenic
1050729915 9:8697271-8697293 TAATAGCCAGAGAAATCTAGAGG + Intronic
1051431191 9:16982553-16982575 CATTAAACAGAGAATTGTTGTGG + Intergenic
1053695615 9:40636807-40636829 TATTAGCCAGTGACATCTAGAGG - Intergenic
1053942606 9:43267846-43267868 TATTAGCCAGTGACATCTAGAGG - Intergenic
1054306862 9:63436025-63436047 TATTAGCCAGTGACATCTAGAGG - Intergenic
1054405593 9:64760013-64760035 TATTAGCCAGTGACATCTAGAGG - Intergenic
1054439220 9:65245500-65245522 TATTAGCCAGTGACATCTAGAGG - Intergenic
1054491186 9:65776439-65776461 TATTAGCCAGTGACATCTAGAGG + Intergenic
1054966674 9:71035882-71035904 TATTAAATAGAGACAAGTAGAGG + Intronic
1057887480 9:98841133-98841155 TATTAACAAGAAAAAGGAAGAGG - Intronic
1059798132 9:117722073-117722095 TATATACCAGAAAAATGTTGTGG + Intergenic
1202778060 9_KI270717v1_random:10419-10441 TATTAGCCAGTGACATCTAGAGG - Intergenic
1186734259 X:12444609-12444631 TATAAACAAGAGAAATATATTGG + Intronic
1189993552 X:46617204-46617226 AATTAACCAAAAAAATGTAATGG - Intronic
1190570198 X:51773326-51773348 TATTAATCAGGTAAATGTAATGG + Intergenic
1191969299 X:66795856-66795878 TAGAAACCAGGGAAGTGTAGTGG - Intergenic
1192016527 X:67337581-67337603 TTTTAATCAGGGAAATGGAGTGG - Intergenic
1192331255 X:70177197-70177219 TCTTAAGCAGGGAAAGGTAGTGG + Intergenic
1192456325 X:71279143-71279165 TAATAACCAGTTAAATGTAGGGG - Intergenic
1193709459 X:84861287-84861309 TATTAATCAGGGAAAGGTAATGG - Intergenic
1194405246 X:93488749-93488771 GATTAACAATTGAAATGTAGAGG + Intergenic
1194589346 X:95778826-95778848 TATTAATCAGATATATGTAGAGG + Intergenic
1194806586 X:98336649-98336671 TATTCAACAGAGAAGTGTACTGG - Intergenic
1195398407 X:104435744-104435766 TTCTAGCCAGAGAAATGCAGAGG + Intergenic
1195814048 X:108866410-108866432 TATTGCCCATAGAAGTGTAGAGG + Intergenic
1196053202 X:111327353-111327375 TGTTAGCCAGGGACATGTAGAGG - Intronic
1196837009 X:119822911-119822933 TATTAGCCATAGAAAAGAAGAGG - Intergenic
1199000284 X:142628310-142628332 TATTACCCAAAGAAATACAGAGG - Intergenic
1199046375 X:143178822-143178844 TATTAACTGGAGAAATATAAAGG + Intergenic
1200125467 X:153811969-153811991 TTTTAACCGTAGAAATGTACAGG + Intronic
1201120431 Y:10868651-10868673 AATTAAGCAGTGAAATGGAGTGG - Intergenic