ID: 935656726

View in Genome Browser
Species Human (GRCh38)
Location 2:105429572-105429594
Sequence CATTCTGGAGGCTCTAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 3, 2: 12, 3: 83, 4: 363}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935656726_935656730 3 Left 935656726 2:105429572-105429594 CCTTCTCTAGAGCCTCCAGAATG 0: 1
1: 3
2: 12
3: 83
4: 363
Right 935656730 2:105429598-105429620 CCCTGCTGATACCTTGATTCTGG 0: 1
1: 15
2: 160
3: 624
4: 1540

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935656726 Original CRISPR CATTCTGGAGGCTCTAGAGA AGG (reversed) Intronic
900209027 1:1444452-1444474 CATTTTGGAAGCTGGAGAGAAGG + Intergenic
900390420 1:2431570-2431592 GACTCTGGAAGCTCTGGAGAAGG - Intronic
901498628 1:9637606-9637628 CTCTCTGGAGGCTGTAGGGAAGG + Intergenic
905413684 1:37790239-37790261 CTTTCTGGAGGCTCTAGGAACGG - Intergenic
905414096 1:37793330-37793352 CTTTCTGGAGGCTCTAGGAACGG - Intergenic
905929411 1:41776733-41776755 CATTCTGGAGGCTTCAGAGAAGG + Intronic
907394453 1:54179487-54179509 CTTTCTGGAGGAGGTAGAGAGGG - Intronic
907836545 1:58114309-58114331 CCTTCAGGAGGCTCTACATATGG - Intronic
907870965 1:58442324-58442346 CATTCTGGAGGTTTTGGAGCGGG - Intronic
908940866 1:69431756-69431778 CATTCTGGAGTCACTAGCGATGG + Intergenic
910113037 1:83702167-83702189 CCTTCTGGAGGCTCTAGGAGGGG + Intergenic
910127420 1:83859565-83859587 CATTCTGAAGGCTCTATCGTAGG + Intergenic
910832837 1:91477868-91477890 CCTTCTGAAGCCTCTAGAGGAGG - Intergenic
912142759 1:106751444-106751466 CAACCTGGAAGCTCTAGAGCTGG - Intergenic
912439493 1:109687720-109687742 CATTCTGGAGGCCCGGGAGAGGG - Intronic
912617049 1:111112989-111113011 CCCTCTCAAGGCTCTAGAGAAGG + Intergenic
914934007 1:151962000-151962022 CCCTCTGGAGGCTCTAGGGGAGG + Intergenic
915106782 1:153539815-153539837 GAGTCTGGAGGGTTTAGAGAAGG - Intronic
918270860 1:182897836-182897858 CTTTTTGGATGCTCTAGGGAAGG - Intergenic
919945411 1:202315708-202315730 CACTCTATAGGCTTTAGAGAGGG - Intronic
920235417 1:204500139-204500161 CTTCCTGGAGGCTCTAGGGCAGG - Intergenic
921408679 1:214811135-214811157 TTTTATGGAGGCTCTAGAGGAGG + Intergenic
921670679 1:217920704-217920726 CCCTCTGAAGGCTCTAGGGAAGG - Intergenic
922303432 1:224323669-224323691 CCTTCAGGAGGCTCAAAAGAAGG + Intronic
922560778 1:226568165-226568187 CATTCTGCAGGCTCTGGCAACGG + Intronic
922654116 1:227365922-227365944 CTTTCTGGAGGCTCAAGGGCAGG + Intergenic
1065316936 10:24472823-24472845 CCCTCTGGAGGCTCCAGAGTGGG + Intronic
1065347474 10:24762676-24762698 CATGCTGAAGGCTCTGCAGAAGG + Intergenic
1065849772 10:29778071-29778093 CCCTCTGAAGGCTCTAGAGTAGG - Intergenic
1067899473 10:50223928-50223950 CCTTCTGGAGGCTCTAAGGGGGG - Intronic
1068602525 10:58970463-58970485 CCTTCTGGAGGCTCTAGAGAAGG - Intergenic
1071962907 10:90823947-90823969 AATTCTGAAGGCTCTACAGGAGG - Intronic
1072000711 10:91193239-91193261 CCTTTTGGAGGCTCTAGGGATGG - Intronic
1072568098 10:96634852-96634874 CTTTCTGGAAGCTATAGAGGAGG + Intronic
1074058899 10:109947019-109947041 CACTCTGGAAGCTATAGAGCTGG - Intronic
1074188729 10:111117660-111117682 CAGTGTGGAGGCCCCAGAGAGGG + Intergenic
1074429058 10:113377818-113377840 CAAAATGGAGGGTCTAGAGAAGG + Intergenic
1074760968 10:116667265-116667287 CTTTCTGAAGGCGCTAGGGAAGG - Intronic
1075215182 10:120526542-120526564 CATTCTGGAAGCTGTGCAGAAGG + Intronic
1075280251 10:121132789-121132811 TATTCTGAAGGCTCTCTAGAAGG - Intergenic
1076228214 10:128797975-128797997 CCCTCTGAAGGCTCTAGAGGAGG - Intergenic
1077546296 11:3171619-3171641 CCTTCTGGAGGCTCTGGGGGAGG + Intergenic
1077798589 11:5516409-5516431 CATCCTGGATGTTCGAGAGATGG + Exonic
1077909116 11:6558775-6558797 GGCTCTGTAGGCTCTAGAGAGGG - Intronic
1078862065 11:15257798-15257820 CCCTCTGAAGGCACTAGAGACGG - Intergenic
1079098578 11:17526887-17526909 GAGGCTGGAGGCTCTAGACATGG - Intronic
1080464708 11:32485956-32485978 CAGTCTGGAGACACTGGAGACGG + Intergenic
1081069668 11:38595456-38595478 CTTTCTGGAGGCTCTACAAGTGG - Intergenic
1081350361 11:42044505-42044527 CCTTCTGGAGGCTCTAGGAAAGG + Intergenic
1081877127 11:46416344-46416366 CTCTCTGGATGCTCCAGAGATGG + Intronic
1083159238 11:60844414-60844436 CAGTGTGGAAGCTCTAGTGATGG - Intronic
1083302954 11:61748326-61748348 CATTGGGGAGGGTCTTGAGAGGG + Intergenic
1084106353 11:66983353-66983375 CCCTCTCGAGGCTCTAGAGGAGG - Intergenic
1084309125 11:68305980-68306002 CCGTCTGGAGGCTCTAGGGGAGG + Intergenic
1084496535 11:69507804-69507826 TGTTCTGGAGGTTCTAGAGGGGG - Intergenic
1084533005 11:69740285-69740307 CCTTCTGAAGGCTCCAGGGAAGG + Intergenic
1084599451 11:70136214-70136236 CCTGCTGGAGGCTCTAGACCTGG + Intronic
1085150953 11:74252539-74252561 GATCCTGGAAGCTCTAGAGCAGG + Intronic
1085154471 11:74280798-74280820 CATTATGGAAGCTTCAGAGAAGG - Intronic
1085967749 11:81549124-81549146 TTTTTTGGAGGCTCTAAAGAAGG - Intergenic
1086762928 11:90656259-90656281 TTTTCTGGAGACTCTAGAGAAGG + Intergenic
1086975233 11:93124438-93124460 GATTCTTGAGGCTCTTGAAATGG + Intergenic
1089336771 11:117730362-117730384 CTTTCTGGAGGCTGTAGGGGAGG - Intronic
1090280669 11:125453392-125453414 AATTCTAGAGAGTCTAGAGAAGG - Intronic
1094249442 12:28342221-28342243 CTATCTGGAGGCTCTAGGGAAGG - Intronic
1094777231 12:33744903-33744925 AGTTCTGCAGGCTCTACAGAAGG - Intergenic
1095615647 12:44184687-44184709 CTTTCTGGAGGCTCTAGGAAAGG - Intronic
1095954458 12:47798360-47798382 GTGTCTGGAGGCTCTAGGGAGGG - Intronic
1097495106 12:60322150-60322172 CCTTCTGGAGGCTCTGAAGGTGG - Intergenic
1097527717 12:60759226-60759248 CTTTCTGGAGGCTCTTGGGGAGG + Intergenic
1097577170 12:61409340-61409362 TATTCTGGGGTCTGTAGAGAGGG + Intergenic
1097896445 12:64828555-64828577 CATTCCAGAGGCTCTAAAGAAGG - Intronic
1097980285 12:65730972-65730994 CATACTGAAGGCTCTAGAAGAGG - Intergenic
1098204902 12:68098424-68098446 CTCTCTGAAGGCTCTAGAGGAGG + Intergenic
1098470697 12:70840172-70840194 CTTTCTGGAGGTTCTGGAGGGGG + Intronic
1100310536 12:93390954-93390976 CATTTTGGGGGCTTGAGAGAAGG + Intronic
1101558173 12:105830511-105830533 CATTCTGGAGGCTCTGAAGAAGG + Intergenic
1101763949 12:107681943-107681965 CAGACAGGAGGCCCTAGAGAGGG + Intergenic
1102162286 12:110779265-110779287 CAATCTTGAGACTCTAGAGGAGG + Intergenic
1102231639 12:111266624-111266646 CCTTCTGAAGACTCTAGGGAAGG - Intronic
1102596377 12:113995884-113995906 CTTTCTGCGGGCTCTTGAGAAGG + Intergenic
1103230371 12:119325386-119325408 CTCTCTGAAGGCTCTAGGGAAGG + Intergenic
1103706765 12:122879088-122879110 CCCTCTGGAGGCTCTAGGGGAGG - Intronic
1103963869 12:124625947-124625969 CCTTCTGGAGGGTCCAGAGGAGG - Intergenic
1104395082 12:128425664-128425686 CCCTCCGAAGGCTCTAGAGAAGG + Intronic
1104400625 12:128473010-128473032 CCTTCTGGAGGATCTAGGGAAGG + Intronic
1104502323 12:129297916-129297938 CACTCTGGAGGCTTTTGAGCTGG + Intronic
1105513630 13:21072128-21072150 CTTCCTGGAGGCTCTAGCAAAGG - Intergenic
1106335269 13:28777967-28777989 CAGTCTGGAGGCTCAGGAGAAGG + Intergenic
1106391460 13:29339030-29339052 CAGTCTGGAGGCTCAGGAGAAGG + Intronic
1107653993 13:42573894-42573916 CTTTCTGGAGGTCCAAGAGATGG - Intronic
1108751768 13:53454979-53455001 CCTTCTGGAGCCTCTAGGGGAGG - Intergenic
1111040896 13:82746157-82746179 GATTCTGCAGGCTCTACAGGAGG + Intergenic
1111501106 13:89120957-89120979 CCTTCTGGAGGCTCCAGGGAAGG - Intergenic
1112218293 13:97459516-97459538 CCTGCAGGAGGCTGTAGAGATGG + Intronic
1112458064 13:99579689-99579711 CATTCAGCAGACTCTAGAAAAGG + Intergenic
1113489978 13:110683941-110683963 CTTGCAGGAGGCTCTGGAGAAGG - Intronic
1114033851 14:18602022-18602044 TATTCTGGAGGCTATAGATAAGG - Exonic
1114078645 14:19181196-19181218 TATTCTGGAGGCTATAGATAAGG - Intergenic
1114124794 14:19712989-19713011 TATTCTGGAGGCTATAGATAAGG + Intergenic
1114650692 14:24282748-24282770 CATTCTCAAGGGTCTACAGAAGG + Intergenic
1115094331 14:29616713-29616735 CTTTCTGGAGGTTCTAGAGGGGG + Intronic
1117798737 14:59421943-59421965 CATTTTGGAGGCAAAAGAGAAGG + Intergenic
1118534385 14:66743437-66743459 TTTTCTGGATGCTCTAGTGAAGG - Intronic
1120758432 14:88265445-88265467 CCTTCGGGAGGCTCTAGGGGAGG - Intronic
1121480867 14:94271637-94271659 CATACTGGAAGTTCTAGAAAAGG + Intronic
1121519974 14:94579362-94579384 CTTTCTGGAGGCTCTAGGGGAGG + Intronic
1121529916 14:94644986-94645008 CAGTCTGCAGGTTCTAGAAATGG - Intergenic
1123049400 14:105533419-105533441 CATTCTGGGGGCTTCTGAGAAGG - Intergenic
1123568257 15:21574278-21574300 TATTCTGGAGGCTATAGATAAGG + Intergenic
1123604365 15:22009600-22009622 TATTCTGGAGGCTATAGATAAGG + Intergenic
1124229262 15:27928545-27928567 CTGTCTGGAGGCTCTAGGGGAGG + Intronic
1124545235 15:30620672-30620694 CCTTCAGGAAGCTCTAGAGCTGG + Intergenic
1124778760 15:32610064-32610086 CCTTCAGGAAGCTCTAGAGCTGG + Intergenic
1127299413 15:57638264-57638286 CATTCAGGGGTCTCTAGTGAAGG + Intronic
1129185158 15:73901624-73901646 CCTTCTGGAGACTCTAGGGGAGG + Intergenic
1130419841 15:83734250-83734272 GGTTCTGAAGGCTCAAGAGAGGG - Intronic
1202976614 15_KI270727v1_random:301366-301388 TATTCTGGAGGCTATAGATAAGG + Intergenic
1133330039 16:4967192-4967214 CCCTCTGGAGGCTCTAGAAGGGG + Intronic
1133835896 16:9366902-9366924 CCTTCTGAAGGCTCCAGGGAGGG + Intergenic
1134371862 16:13633371-13633393 CCTTTTGGAGGCTCTAGAGGAGG - Intergenic
1134389973 16:13810611-13810633 GATTCTTGATGCTCCAGAGATGG + Intergenic
1135285965 16:21193446-21193468 CCTTCTGGAGGATCTAGGGGAGG + Intergenic
1137519222 16:49177944-49177966 CATTCTGGAGACTCTGGGGCTGG + Intergenic
1139223586 16:65211579-65211601 CACTCTGGATGCTAAAGAGAGGG + Intergenic
1139509684 16:67420041-67420063 CCTTCTGGAGCCTCTAGAGGAGG - Intergenic
1140024662 16:71274938-71274960 CACTCTGAAGGCACTAGGGAAGG - Intergenic
1140280631 16:73551600-73551622 CAGTCTGGAACCTCTAGAGCTGG + Intergenic
1141551594 16:84810035-84810057 CCCTCTGAAGGCTCTAGAGGAGG - Intergenic
1141601722 16:85130787-85130809 GTTTCTGGGGGCTCTAGGGAGGG + Intergenic
1141854689 16:86673077-86673099 CCTTCAGGAGGCTCCAGGGAGGG - Intergenic
1141973024 16:87495634-87495656 CCCTCTGGAGGCTCTAGGGGAGG - Intergenic
1143333151 17:6152677-6152699 CCTTCTGGAGGCTCTAGAGAAGG - Intergenic
1143395743 17:6594204-6594226 CATTCTGGAGGCTCCAGGGAAGG - Intronic
1143519051 17:7435388-7435410 CTTTCTGGAGGCTGTCGAGGTGG - Intergenic
1143830470 17:9646450-9646472 CAGACTGGAAGCTCTAGAGCTGG - Intronic
1143907748 17:10223054-10223076 CCTTCTGAAGGCTCTAGGGGAGG + Intergenic
1144153668 17:12476107-12476129 CTTTCTGGAGGCCCTAGGGGAGG - Intergenic
1146178624 17:30683045-30683067 CCCTCTGGAGGCTCTAGGGGAGG + Intergenic
1146456189 17:33011634-33011656 CTTTCTGGAAGCTCTACAGGAGG - Intergenic
1148472201 17:47901821-47901843 AATCCTGGAGGCTTTAGAGCAGG - Intronic
1148562856 17:48616107-48616129 CCTTTTGGGGGCTCCAGAGAAGG - Intronic
1151369819 17:73640729-73640751 CTTTCAGGAGCCTCTAGAGCTGG + Intronic
1151535002 17:74734150-74734172 CCCTCTGAAGGCTCCAGAGAAGG + Intronic
1151945448 17:77317276-77317298 CCCTCTGGAGGCTCTAGGGCAGG + Intronic
1151991488 17:77577762-77577784 CCTTCTGGAGGCTGTAGGGGAGG + Intergenic
1152474976 17:80512141-80512163 CTCTCTGGAGGGTCTTGAGAAGG + Intergenic
1152826979 17:82472754-82472776 GATTCTGCAGGCTCTAGATGAGG + Intronic
1153842813 18:9022409-9022431 CATGCTGGAGCCTCGAGAAAAGG + Intergenic
1155393654 18:25363864-25363886 CATTCTGGAGGGGCCTGAGAAGG - Intergenic
1157082631 18:44542995-44543017 AGGTCTGGAGGCTATAGAGACGG - Intergenic
1157428969 18:47607787-47607809 TTTTCTGGAGGCTCTGGAGGAGG + Intergenic
1157870443 18:51225538-51225560 CATTCTGGAAGCTGTAGAAGAGG - Intergenic
1157881887 18:51328643-51328665 CCTTCTGGAGTCTCTCGAGGAGG + Intergenic
1158424693 18:57328297-57328319 CTTTCTGGAGGTTCTAGGAAAGG + Intergenic
1159052932 18:63438344-63438366 CCCTCTGAAGGCTCTAGTGAAGG + Intergenic
1159373934 18:67566684-67566706 CCTTCTGGAGGCTCTAGGGAAGG - Intergenic
1159754620 18:72348980-72349002 CTTTCTGGAGGCTCTAGAGAAGG - Intergenic
1159907399 18:74107945-74107967 CATTCTGGAGGTTGTAAAGCGGG + Intronic
1160257095 18:77256659-77256681 CACTCTGGTGGCTTTAGGGAGGG - Intronic
1160701474 19:509525-509547 CCCTCTGGAGGCTCCAGGGAAGG + Intronic
1161148150 19:2692012-2692034 CCTTCTAGAGGCTCCAGGGAAGG - Intronic
1161664716 19:5568227-5568249 CATGGTGGAGGCTCCAGGGAGGG + Intergenic
1161697411 19:5777228-5777250 TAGTCTGGGGCCTCTAGAGAAGG - Intronic
1162179835 19:8860898-8860920 ATTGGTGGAGGCTCTAGAGAGGG - Intronic
1162979991 19:14232527-14232549 CCCTCTGGAGGCTCTAGGGGAGG - Intergenic
1164431208 19:28190427-28190449 GATTTTGGTGGCTCTGGAGAGGG - Intergenic
1165220387 19:34311408-34311430 CATTCTGCACGCACTGGAGACGG - Intronic
1166581743 19:43906494-43906516 CATGCTGGAGGTTCTAGCCAGGG + Intergenic
1166606932 19:44151645-44151667 CTTCCCGGAGGCTCTAGGGAAGG + Intronic
1166971919 19:46574601-46574623 CCTTCTGGAGGCTCTAGGGCAGG + Intronic
1167180736 19:47901528-47901550 CCCTCTGGAGGCTCTGGGGAAGG - Intergenic
1167680789 19:50919328-50919350 CCTTCTGGAGGCTTCAGAGGAGG + Intergenic
1167683614 19:50941662-50941684 CCTTCTGGAGGCTCTAGGGGAGG + Intergenic
1167717320 19:51152116-51152138 CCTTCTGGAGGCTCCAGGGGAGG + Intronic
1168280066 19:55300890-55300912 TCCTCTGGAGGCTCTAGGGAAGG + Intronic
1168334570 19:55590470-55590492 CATTCTGAAGGCAATAGGGAAGG - Intergenic
1168641789 19:58035483-58035505 CACCCTGGAGACTCTAGGGAGGG - Intronic
1168646897 19:58065151-58065173 CCTTCTGGAGGCTCTAGGGAAGG + Intronic
1168651638 19:58095984-58096006 ATTTCTGGAGGCTCTTGAGATGG - Intronic
926572540 2:14545093-14545115 CCTTCTGGAGGCTCTAAGGCAGG - Intergenic
927479704 2:23442566-23442588 CCTTCTGGAGGCTCCGGGGAAGG - Intronic
927766035 2:25809210-25809232 CATTCTGCAGGCAGTTGAGAGGG + Intronic
928041953 2:27887303-27887325 CATTCTGGAGACTCTAGAGGAGG - Intronic
928948291 2:36791728-36791750 CTCCCTGGAGCCTCTAGAGAGGG + Intronic
929113332 2:38423567-38423589 CATTCTGCAGGCTGTACAGGAGG - Intergenic
929123477 2:38502244-38502266 CCTTCTGGAGGCTTTAGAAAAGG + Intergenic
929366255 2:41160042-41160064 CTTTCTGGAGGTTCGAGGGATGG + Intergenic
929801303 2:45105547-45105569 CTTTCTGGAGGCTCTAGGGCAGG - Intergenic
930781108 2:55225301-55225323 CAATCTGGAAGGTCTAGAGCGGG + Intronic
932163471 2:69484413-69484435 CATTCCGTAGACTCCAGAGATGG - Intronic
932917684 2:75875600-75875622 GATTTTGGAGGCTCTGGAAAAGG + Intergenic
933561928 2:83898334-83898356 CATTCTGGAGGATCTAGGGGAGG - Intergenic
935348724 2:102134765-102134787 CCTTCTGCAGTCTCAAGAGAAGG - Intronic
935656726 2:105429572-105429594 CATTCTGGAGGCTCTAGAGAAGG - Intronic
936980561 2:118261455-118261477 CACTCTGGAGCCACTAGGGAAGG - Intergenic
937082636 2:119151379-119151401 CATCCTGGGGGATCTTGAGAAGG - Intergenic
938749840 2:134317982-134318004 CAGTCTGGAGGCTTCAGAGCAGG - Intronic
940020842 2:149154380-149154402 CACTCTGGAGGCTCTGAGGAAGG - Intronic
940274129 2:151921553-151921575 CCTTCTGGAGGCTCTAAGGGAGG + Intronic
940758905 2:157716027-157716049 CTTTCTGGAGGCTCTAGGAGAGG + Intergenic
940868846 2:158843086-158843108 CTTTCTGGAGGCTCTAGAAGAGG + Intronic
941589029 2:167395500-167395522 CTTTCTGGAGGTTCTGGGGAGGG - Intergenic
941619740 2:167763487-167763509 CATAGAGGAGGCTCTAGTGAAGG - Intergenic
943399961 2:187395739-187395761 CATTCATGAGGTTCTAGCGAGGG + Intronic
944290729 2:198001648-198001670 CATTCTCATGGCTCTAGAGCAGG + Intronic
944501419 2:200364164-200364186 CTTTTTGGAAGCTCTAGAGAAGG - Intronic
946054525 2:216889210-216889232 GAGTCTGGAGTCTCAAGAGATGG + Intergenic
946948587 2:224848126-224848148 CCTTCAGGAGGTTCTAGGGAAGG - Intronic
947492953 2:230611516-230611538 CTTTCTGGAGAATCTGGAGAGGG - Intergenic
947984329 2:234436214-234436236 TATTCTGGAAGCACTCGAGATGG - Intergenic
948114316 2:235482891-235482913 CTTTCTGGAGGCTCTAGGAGAGG - Intergenic
1169163996 20:3407296-3407318 CATTGTGGGGCCTCTACAGAGGG + Intronic
1170819291 20:19742727-19742749 CATTTTAGAGGCTCTAGCTAGGG + Intergenic
1171183813 20:23110737-23110759 CACTCTGAAGCCTCTAGGGAAGG + Intergenic
1171262259 20:23745233-23745255 GATTCTTGAGGCTGTAGTGATGG - Intergenic
1172147752 20:32768679-32768701 GATACAGGAGGCTCTGGAGATGG + Intronic
1173329747 20:42065156-42065178 CAGTCTGGCAGCTCTTGAGAAGG - Intergenic
1173492715 20:43496230-43496252 CTTTCTGGAGGCTCTAGGAGAGG - Intergenic
1174115370 20:48223292-48223314 CAGTCAGGTGGCTCTAGACAAGG - Intergenic
1174868007 20:54156562-54156584 CTTTCTGGAGGTTCTAGAGGAGG - Intronic
1175302196 20:57950960-57950982 GCTTCTGGAGGCTCCAGAGGAGG - Intergenic
1175377287 20:58536979-58537001 CAATCTGAAGGCTCTATAAAGGG - Intergenic
1175582990 20:60114831-60114853 CTGTCTGGAGACTCTAGGGAGGG - Intergenic
1175597221 20:60244789-60244811 CATTCTTCAGGCTCCAGATAGGG - Intergenic
1177140204 21:17350369-17350391 CTTTCCGGAGGCTCTAGGGGAGG + Intergenic
1177377155 21:20285948-20285970 CACTCTGAAGGCACTAGGGAAGG - Intergenic
1177726653 21:24977406-24977428 CATTCTAGAGGCTCTAGTGGAGG - Intergenic
1178246803 21:30960855-30960877 CTCTCTGGAGGCTCTAGGGAAGG - Intergenic
1178804544 21:35828052-35828074 GAATCTGGAGGCTCTATACATGG + Intronic
1179344549 21:40544620-40544642 CTTTCTGAAAGCTCTAGAGGAGG - Intronic
1180457968 22:15529064-15529086 TATTCTGGAGGCTATAGATAAGG - Exonic
1181372521 22:22429620-22429642 CATTCTGAAAGGTCTAGATATGG + Intergenic
1181733962 22:24867582-24867604 CAGTCTGGAAGCTCCAGAGCCGG + Intronic
1181812396 22:25411706-25411728 CCCTCTGGAGGCTCTAGGGGAGG - Intergenic
1181975619 22:26727308-26727330 AATTCTGGAGGCTATACAGGAGG + Intergenic
1182096421 22:27629054-27629076 CCTTCTGGAGGCTCTAGGACAGG + Intergenic
1182761474 22:32725702-32725724 CTTTCTGGAGGATCTAGGGGAGG - Intronic
1182930652 22:34170981-34171003 CTTTCTGGAGGCTCTGAAGAAGG + Intergenic
1182937838 22:34242971-34242993 TATTTTGGAGGGTCTGGAGATGG + Intergenic
1183014522 22:34974900-34974922 CATTCTGCAGGCTATACAGGAGG + Intergenic
1183040028 22:35171020-35171042 CTTCTTGGAGGCTCTAGGGAAGG - Intergenic
1184283947 22:43455963-43455985 CCTTCTGGAGGCTCTGGTGAGGG + Intronic
1184414209 22:44342752-44342774 CATTCTGGGGGACCTAGAGCAGG - Intergenic
1184498931 22:44860342-44860364 CCTTCCAGAGGCTCTAGGGAAGG + Intronic
1184710067 22:46244615-46244637 CAGTCTGGAAGGTCTAGAGGGGG - Exonic
1184931922 22:47687730-47687752 CCTTCTGGAGGCTCTGGAAGAGG + Intergenic
1185188709 22:49418932-49418954 CCTTCTGGAGGCTCTAGGGGAGG + Intronic
950067500 3:10124687-10124709 CTTTCTGGAGGCTCTAGGAGAGG + Intronic
950690243 3:14650420-14650442 CCTTCTGGAGACTCTGGAGGAGG + Intergenic
951051241 3:18096495-18096517 CTTTCTGGAGGCTCTAGGGGAGG + Intronic
952852725 3:37742121-37742143 CATTCTGGAGGGACTAGGGGCGG - Intronic
954554244 3:51505752-51505774 CAGCCTGTAGGCTCTGGAGAGGG + Intergenic
955218396 3:57003850-57003872 CCTTCTGGAGGCCATAGGGAAGG - Intronic
955234122 3:57124592-57124614 CCTTCTGGAGGCTGTAGGGGAGG - Intronic
955934426 3:64089263-64089285 AATTCTGGAGGATCTGGAGTGGG - Intergenic
956146122 3:66192360-66192382 CATGCTGGAGGGTCGAGAGAGGG - Intronic
956748496 3:72328373-72328395 CAGTCTGGAAGCTTTAGGGAAGG + Intergenic
957032894 3:75263574-75263596 CATTTTGGAGACTTTAGGGATGG - Intergenic
960636938 3:119793470-119793492 CCTTCTGGAGGCTGTAGGGGAGG + Intronic
961093649 3:124136886-124136908 AATTATGGAGGCACTAGTGATGG + Intronic
961452174 3:127007194-127007216 CTTCCTGGAGGCTGTTGAGATGG + Intronic
962274912 3:134004795-134004817 CCTTCTGGAGGCTTTAGTGGAGG - Intronic
962608998 3:137057223-137057245 GCTTCTGAAGGCTCAAGAGAAGG + Intergenic
962627574 3:137241763-137241785 CATCATGGAGGCTCTGGAGAAGG - Intergenic
967164193 3:186765970-186765992 CCTTCTGGAGGCTCCAGGGCAGG - Intergenic
968006386 3:195245933-195245955 GGTTCTGCAGGCTGTAGAGAAGG - Intronic
969065317 4:4474781-4474803 TTTTCTGGAGGCTCTAAGGAAGG - Intronic
969468435 4:7371397-7371419 CATTCTGAATGCTCTTCAGAGGG + Intronic
969526186 4:7705267-7705289 CCCTCTAGAGGCTCTAGAGGCGG - Intronic
970414302 4:15841379-15841401 GATTCTGGAGACTCTACTGATGG + Intronic
970438791 4:16061766-16061788 CCTTCTGAAGCCTCTAAAGAAGG + Intronic
971500175 4:27310503-27310525 CATTCTGGAGGATGGAGAGAAGG - Intergenic
971819366 4:31531114-31531136 CAGTGTGGAGGCTCCAGTGAAGG + Intergenic
975968467 4:80004485-80004507 CTTCCTGTAGGCTCTAGGGATGG + Intronic
976596220 4:86897572-86897594 CATTTTGGTTGCTCTAGAGTGGG + Intronic
977576947 4:98684981-98685003 CTTTCTGGAGGCTCTAGGCAGGG + Intergenic
978827702 4:113044607-113044629 CCTTCTGAAGGCTCTGGAGAAGG + Intronic
982635791 4:157895268-157895290 CATTCTGTAGGCTCTGCAGTGGG - Intergenic
982996026 4:162346800-162346822 TTTTGTGGAGGCTCTAGAGGAGG - Intergenic
983302567 4:165946197-165946219 CATTCTGGAGGCTCTGGAAAAGG - Intronic
983475268 4:168205196-168205218 CCTTCTGGAGGCTCTAATGGAGG + Intergenic
983644494 4:169976226-169976248 CATTCTAGAGGCAGTAGTGAGGG - Intergenic
984651032 4:182270776-182270798 CAGTCTGGACCCTCTAAAGATGG + Intronic
985618120 5:936841-936863 CATTCTGGAGCCACCACAGAAGG - Intergenic
985960189 5:3296092-3296114 CCTTCAGAAGGCTCTAGAGGAGG - Intergenic
986206280 5:5628198-5628220 CATTCTGGAGGCTCAGAGGAGGG + Intergenic
986717163 5:10533041-10533063 CCTTCTGGAGGCTCTAAGGGAGG - Intergenic
987387849 5:17347195-17347217 CTTTCTGGAGGCTCTAGAATTGG + Intergenic
989242376 5:39216074-39216096 CCCTCTGGAGGCTCTAGGGGAGG - Intronic
991256274 5:64618511-64618533 CCTTCCAGAGGCTCTAGAGAAGG + Intergenic
992093563 5:73340125-73340147 ACCTCTGGAGGCTCTAGGGAAGG + Intergenic
992880075 5:81099160-81099182 GATTGTGGAGACTTTAGAGATGG - Intronic
993813171 5:92508757-92508779 CATTCTGCAGGCTGTACAGGAGG - Intergenic
994724369 5:103416815-103416837 CCTTCTGGAAGCTCTGGGGAAGG + Intergenic
995133804 5:108659077-108659099 CATTATGGTGGCTCTTGTGAAGG + Intergenic
995137451 5:108695407-108695429 CCTTCTGGAGGCTCTACGGGAGG - Intergenic
995151041 5:108845631-108845653 CATACTGGAGGATCTAGCCAGGG - Intronic
996121940 5:119682076-119682098 GATTCTGAGGGCTCTAGAGTAGG + Intergenic
996555667 5:124776672-124776694 CTTTCTGGAGGTTCTAGGGGAGG + Intergenic
997232268 5:132253695-132253717 GATGCTGGAGGCTCCAGAGGGGG - Intronic
997351593 5:133235015-133235037 CATTCTGGTGGCAGGAGAGAAGG + Intronic
999260350 5:150234694-150234716 CATCCTGGAGTCTCTAGTCAGGG + Intronic
999681912 5:154068483-154068505 CTCTCTGAAGGCTCTAGGGAAGG + Intronic
1000111577 5:158113135-158113157 GATGCTGGAGGCTTTAGAGAGGG - Intergenic
1001265749 5:170273479-170273501 CCTTCTGAAGGCACTAGAGGTGG + Intronic
1002150414 5:177224696-177224718 CACACTGGAGGCTCTAGCCAGGG - Intronic
1002993355 6:2258399-2258421 CGCTCTGCAGGCTCTAGGGAAGG + Intergenic
1003075068 6:2976468-2976490 CAGGCAGGAGGCTCTGGAGACGG - Intergenic
1004905617 6:20234636-20234658 TTTTCTGGAGGGTCTAGAGGAGG + Intergenic
1005005977 6:21288033-21288055 CTTTCTGAAGGCTCTAGGGGAGG + Intergenic
1005275413 6:24211733-24211755 CCTTCTGGAGGCTCTAGGCAAGG - Intronic
1005662561 6:28014071-28014093 CCTTCTGGATACTCTAGTGAAGG - Intergenic
1006585885 6:35111751-35111773 CCTTCTTGGGGCTCTAGGGATGG - Intergenic
1007415355 6:41688297-41688319 CATTATGGAAGCCCTAGAGCAGG + Intronic
1011705117 6:89993455-89993477 ATTTCTGGAGGCTCCTGAGAAGG + Intronic
1012755787 6:103228320-103228342 CATTCTGGAGTCTGGAGGGATGG - Intergenic
1013041501 6:106438446-106438468 CCTTCTGAAGGCTCTAGGGAAGG + Intergenic
1014049095 6:116930920-116930942 CATTCTGGTTGCTCTCGGGAAGG + Intronic
1014760304 6:125348913-125348935 CCCTCTGAAGGCTCTAGGGAAGG - Intergenic
1015212188 6:130710939-130710961 CCTCCTGGAGGATCTAGAGGAGG + Intergenic
1016444700 6:144119780-144119802 GACTTTGGAGGCTCTAGAAAAGG - Intergenic
1017096378 6:150809017-150809039 CATTCTTGAGGCTCAACAGATGG + Intronic
1018234779 6:161713424-161713446 CAATCTGGAGGCTCTCTAGGGGG + Intronic
1018471770 6:164103797-164103819 CATTCTGAAGGCTGTTGATATGG - Intergenic
1018511886 6:164533131-164533153 CATCCTGGAGTCTCTGCAGAGGG - Intergenic
1019046029 6:169146879-169146901 CTTTCTGGAGGCTATGGAGAGGG - Intergenic
1019091632 6:169540170-169540192 CATTCTAGGGGCCATAGAGAAGG - Intronic
1020183342 7:5939655-5939677 TATTTTGGAGGCACTAGAGAAGG - Intronic
1020299570 7:6785103-6785125 TATTTTGGAGGCACTAGAGAAGG + Intronic
1020707131 7:11559191-11559213 CTTTCTGGAGGCTCTAGGGGAGG - Intronic
1022951026 7:35337992-35338014 CACTCTGAAGGCTCTAGGGTAGG - Intergenic
1023381573 7:39613299-39613321 CCTTCTGAAGGCTCTAGGGCAGG - Intergenic
1024995217 7:55268946-55268968 TCTTCTGGAGGCTCCAGAGGAGG - Intergenic
1026616247 7:71907292-71907314 CATTCTGGAGACGCTTGCGATGG - Intronic
1026840679 7:73668503-73668525 CATTCTGGGGGCGCAAGAGGGGG + Intronic
1028631809 7:92943233-92943255 CTTTGGGGAGGCTCTAGGGATGG - Intergenic
1028947150 7:96592942-96592964 CGTCCTTGAAGCTCTAGAGAAGG + Intronic
1028983883 7:96995273-96995295 CAGGCTGGGGGGTCTAGAGAGGG + Intergenic
1029376357 7:100179198-100179220 ACTTCTGAAGCCTCTAGAGAGGG + Intronic
1030345136 7:108424366-108424388 CTTCCTGGAAGCTCTGGAGAAGG + Intronic
1030686910 7:112496489-112496511 CCTTCTGCTGGCTCTAGAGAGGG + Intergenic
1031137473 7:117900778-117900800 CCTTCTGGAGGCTCTAGGGAAGG + Intergenic
1033350607 7:140559007-140559029 TACTCTGGAGGCTAAAGAGAGGG + Intronic
1033814676 7:145057433-145057455 CCTTCTGGAGGCTCTGGGGGAGG + Intergenic
1034829665 7:154298392-154298414 TATTCTGGAGACACAAGAGAAGG + Intronic
1038370649 8:26986534-26986556 CAATCTGGAAGCTTTAGAGATGG - Intergenic
1038670119 8:29576480-29576502 CATTTTGGGGGCTCAAGAGGAGG + Intergenic
1039394424 8:37212133-37212155 TGTTCTGGAGGCTCTAGCCAGGG + Intergenic
1039413940 8:37377804-37377826 AATTCTTGAGGATCAAGAGAAGG + Intergenic
1039789883 8:40867052-40867074 AATGGTGGAGGCTGTAGAGATGG - Intronic
1041731952 8:61071321-61071343 CCTTCTGGAGGCTGTAGGGCAGG + Intronic
1041802475 8:61814767-61814789 CATTCTGGAAGCTCTAAGGGAGG - Intergenic
1045237403 8:100365370-100365392 CCTTCTGGAGGCTCTAGGAAAGG - Intronic
1045934295 8:107661240-107661262 CATTCTGAAACCTCTAGATATGG + Intergenic
1046111789 8:109734316-109734338 CTTTCTGGAGTCTCTAGGTAGGG - Intergenic
1046518302 8:115292080-115292102 CTTTCTGGAGTCTTTGGAGAAGG + Intergenic
1047193769 8:122702435-122702457 TCTTCTGGAGGCTCTAGAAAAGG + Intergenic
1047745641 8:127842953-127842975 CATTCAGAAGACTCCAGAGAGGG - Intergenic
1048148517 8:131869225-131869247 GAATCTGGAGGCTCAGGAGAGGG - Intergenic
1048921727 8:139237530-139237552 CCCTCTGAAGGTTCTAGAGAAGG - Intergenic
1049004060 8:139843751-139843773 CCTTCTGGAGGCCCTTGAGGAGG - Intronic
1049402914 8:142438407-142438429 CCTTCTGGAGGCTCTGGGGAAGG + Intergenic
1050286563 9:4108815-4108837 CATTCAGAATGTTCTAGAGAGGG - Intronic
1052272435 9:26640827-26640849 CATGGTGGAGACACTAGAGAGGG + Intergenic
1052528978 9:29657045-29657067 GACTCTGGAGGCTCTGGAAAAGG - Intergenic
1053288865 9:36867022-36867044 CATTTTGTAGGCTGTAGAGCTGG - Intronic
1055538556 9:77276629-77276651 CTTTTAGGAGGCTCTAGAGGAGG + Intronic
1055567952 9:77587900-77587922 CCTTCTGGAGGCTCTAAGGGAGG + Intronic
1056029780 9:82541247-82541269 AATTTTGGAGGCTCTATATAAGG - Intergenic
1056464243 9:86838350-86838372 CATTCTGGAGCCTGGTGAGAAGG + Intergenic
1057042363 9:91856989-91857011 GATTCTGGAGACTCAAGACAGGG - Intronic
1057055616 9:91958378-91958400 CCCTCTGAAGGCTCTAGGGAGGG - Intergenic
1057125567 9:92613533-92613555 CCTCCTGGGGGCTCTGGAGACGG + Exonic
1058006822 9:99924788-99924810 CATACTGGAGGCCCTAGCCAGGG - Intronic
1058146054 9:101412734-101412756 TATGCAGAAGGCTCTAGAGAGGG + Intergenic
1058666768 9:107325752-107325774 TATACTGGAGGCTCCAGATAGGG - Intronic
1060231405 9:121827940-121827962 CATTGTGGAGGCTCTGGAAAAGG - Intronic
1061035811 9:128113872-128113894 CCTTCTGGAGGCTCCAGGGCAGG - Intergenic
1061819838 9:133220989-133221011 CCTTCTGGAGGCTCTTGGGCAGG - Intergenic
1062173156 9:135146509-135146531 CACTCTGGAGGCTCTAGGGGAGG + Intergenic
1062185396 9:135215611-135215633 CCTTCTGGAGGCTCAGGGGAGGG - Intergenic
1062240817 9:135536959-135536981 CCTTCTGGAGGCTCTTGGGGAGG + Intergenic
1062307239 9:135914921-135914943 CCTTCTGGAGGCTCTAGGGTAGG - Intergenic
1185452132 X:288302-288324 CCTTCTAGAGGCTCTAGAGTGGG + Intronic
1185455714 X:309715-309737 CCTTCTGGAGGCTCTAGGTGAGG - Intronic
1185455769 X:310054-310076 CCTTCTGGAGGCTCTAGGGGAGG - Intronic
1185455830 X:310394-310416 CCTTCTGGAGGCTCTAGGGGAGG - Intronic
1185456519 X:313456-313478 CCCTCTGGAGGCTCTAGGGCAGG - Intronic
1185484974 X:475271-475293 CCTTCTGGAGGTTCTAGGGGAGG + Intergenic
1185511122 X:665937-665959 CCCTCTGGAGGCTCTAGGGGAGG - Intergenic
1185511160 X:666118-666140 CCTTCTGGAGGCTCTAGGGGAGG - Intergenic
1185523934 X:762226-762248 CTTCCTGGAGGCTCTAGGGGAGG + Intergenic
1185530422 X:814147-814169 CCTTCTGGAGGCTCTAGTGGAGG - Intergenic
1185536788 X:868889-868911 CCTCCTGGAGGCTCTAGGGGAGG + Intergenic
1185536893 X:869570-869592 CCTTCTGGAGGCTCTAGGGGAGG + Intergenic
1185543981 X:926851-926873 CCTTCTGCAGGCTCTAGGGGAGG + Intergenic
1185561172 X:1061627-1061649 CCCTCTGGAGGCTCTAGGGGAGG + Intergenic
1185561232 X:1061968-1061990 CTTTCTGGAGGCTCTAAGGGAGG + Intergenic
1185568540 X:1115019-1115041 CCTTCTGAAGGCTCTAGGGGAGG - Intergenic
1185577158 X:1183364-1183386 CCCTCTGGAGGCTCTAGGGGAGG + Intergenic
1185577217 X:1183707-1183729 CCCTCTGGAGGCTCTAGGGGAGG + Intergenic
1185577276 X:1184048-1184070 CCCTCTGGAGGCTCTAGGGGAGG + Intergenic
1185586750 X:1246730-1246752 CCCTCTGGAGGCTCTAGGGGAGG - Intergenic
1185614790 X:1414218-1414240 CCCTCTGGAGGCTCTAGGGGAGG - Intronic
1185622015 X:1455775-1455797 CCTTCTGGAGGCTCTAGGGGAGG + Intergenic
1185653511 X:1666387-1666409 CCCTCTGGAGGCTCTAGGGGAGG + Intergenic
1185665622 X:1763125-1763147 CCTTCTGGAGGCTCTAGAGGAGG - Intergenic
1185677378 X:1859813-1859835 CCCTCTGGAGGCTCTAGGGGAGG + Intergenic
1185683567 X:1908716-1908738 CCCTCTGGAGGCTCTAGGGGAGG + Intergenic
1185691069 X:2155618-2155640 CCTTCTGGGGGCTCTAGGGGAGG + Intergenic
1185735460 X:2492414-2492436 CATTGTGGAGGCTCTAGAGGAGG - Intronic
1185758215 X:2668803-2668825 CCTTCTGGAGGCTCTAGTGGTGG + Intergenic
1185761109 X:2690739-2690761 CATTTAGGAGGCTGTAGACAGGG + Intergenic
1185792639 X:2938985-2939007 CTTTCTGGATGCTCTAGGGGAGG - Intronic
1185808996 X:3087671-3087693 TCTTCTGGAGGCTCTAGGGGAGG + Intronic
1185813595 X:3132919-3132941 CCTTCCGGAGGCTCTAGGGGAGG + Intergenic
1185831260 X:3305216-3305238 CCCTCTGGAGGCTCTAGAGGAGG + Intergenic
1185837041 X:3354500-3354522 CTCTCTGGAGGCTCTAGGGGAGG + Intergenic
1185838800 X:3369553-3369575 CCCTCTGGAGGCTCTAGGGGAGG + Intergenic
1185839570 X:3376146-3376168 CCTTCTGGAGGCTCTACACAGGG + Intergenic
1185866808 X:3631481-3631503 CCCTCTGGAGGCTCTAGGGGAGG - Intronic
1185874957 X:3694562-3694584 CCTTCTGGAGGCTCTAGGGGAGG - Intronic
1185911352 X:3983954-3983976 CACCCTGGAGGCGCTGGAGAAGG - Intergenic
1185911470 X:3984923-3984945 CTTTCTGGAGGCTGTAGGGAAGG + Intergenic
1185924118 X:4127570-4127592 CTTTCTGGAGGCTCTAGGGGAGG + Intergenic
1185970255 X:4654656-4654678 CCCTCTGGAGGCTCTGGAGGAGG + Intergenic
1186280787 X:7990554-7990576 CTTTCTGGAGGCTTTAGGGGAGG - Intergenic
1186610079 X:11130431-11130453 CCCTCTGAAGGCTCTAGGGAAGG + Intergenic
1186652545 X:11576848-11576870 CCTTCTGGAGACTCTAGAGGAGG + Intronic
1186676054 X:11818562-11818584 CTTTCTGGAGGCTCTAGGGAAGG - Intergenic
1186703183 X:12113409-12113431 CCTTCTGGAGGCTCTCAGGAAGG + Intergenic
1187091507 X:16101770-16101792 CTGTCTGGAGTCTCTAGAGGGGG + Intergenic
1187096392 X:16152728-16152750 CATTCTGAAGGCTCTTTGGAGGG - Exonic
1187107742 X:16261489-16261511 CATTCTGGAAGGTCTAAAAAGGG + Intergenic
1187239918 X:17502967-17502989 GATACTGGAGGCACAAGAGAGGG - Intronic
1187504659 X:19869136-19869158 CCTTCTGGAGGCTCTAGGGGAGG - Intronic
1187578178 X:20580025-20580047 CCCTCTGAAGGCTCTAGGGAAGG + Intergenic
1188464098 X:30458807-30458829 CTGTCTGGTGGCTCTACAGATGG + Intergenic
1189245301 X:39558701-39558723 CCCTCTGGAGGCTCTTGAGGAGG - Intergenic
1189600857 X:42623473-42623495 CATCCTGGAGGCTTTAGTGATGG + Intergenic
1189790180 X:44596334-44596356 TTTTCTGGAGGCCCTAGGGAAGG + Intergenic
1189800234 X:44685164-44685186 GTTTCTGGAGGCTCTGGGGACGG - Intergenic
1190143157 X:47865701-47865723 CATTCTGGATGCTTTAGGTATGG - Intronic
1191677691 X:63808876-63808898 TTTTCTGGAGGCTCTAGAGGAGG - Intergenic
1193090799 X:77492320-77492342 CTTTTTGGAGGCTCTAGATGAGG + Intergenic
1193161479 X:78233504-78233526 TATTCTTGAGGCTGTTGAGATGG - Intergenic
1193865434 X:86725519-86725541 CATTCTTCAGGCTCTAGTGGTGG + Intronic
1194205014 X:91002320-91002342 CAGAGAGGAGGCTCTAGAGAGGG + Intergenic
1194354973 X:92871710-92871732 CTTTCTGGAGACTCTAGAAAAGG + Intergenic
1194467733 X:94254857-94254879 CAGTCTGGAGGCCCCAGTGAAGG - Intergenic
1194584090 X:95712331-95712353 CATACTGGAGGTTCTAGCCAGGG - Intergenic
1195274278 X:103265482-103265504 CATACTGGAGGTTCTAGACAGGG - Intergenic
1197805330 X:130393309-130393331 CCTTCTGGAGGCTCTAGGACAGG - Intergenic
1198095242 X:133373712-133373734 CTTTCTGGAGTCTCTAGAATAGG + Intronic
1200291364 X:154877652-154877674 CTTTCTGGAAGCTCTAGAAAAGG - Intronic
1200550839 Y:4577463-4577485 CAGAGAGGAGGCTCTAGAGAGGG + Intergenic
1201236247 Y:11914718-11914740 CCTTCTGGTGGCTCTATACAGGG - Intergenic
1201236972 Y:11921242-11921264 CCCTCTGGAGGCTCTAGGGGAGG - Intergenic
1201237445 Y:11924611-11924633 CCCTCTGGAGGCTCTAGGGGAGG - Intergenic
1201246099 Y:12005169-12005191 CCTTCTGGAGGCTCTAGAGGAGG + Intergenic
1201280554 Y:12338710-12338732 CTTTCTGGATGCTCTAGGGGAGG + Intergenic