ID: 935656727

View in Genome Browser
Species Human (GRCh38)
Location 2:105429584-105429606
Sequence TCAGCAGGGCTGCATTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 1, 2: 3, 3: 25, 4: 266}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935656727_935656730 -9 Left 935656727 2:105429584-105429606 CCTCCAGAATGCAGCCCTGCTGA 0: 1
1: 1
2: 3
3: 25
4: 266
Right 935656730 2:105429598-105429620 CCCTGCTGATACCTTGATTCTGG 0: 1
1: 15
2: 160
3: 624
4: 1540

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935656727 Original CRISPR TCAGCAGGGCTGCATTCTGG AGG (reversed) Intronic
900753913 1:4420021-4420043 GCAGCAGGGCTGCATTCCTCTGG - Intergenic
901230396 1:7638784-7638806 TAAGCAGCGCTGCCTTCTGGGGG + Intronic
902115497 1:14117591-14117613 TCAGCAGGTCTGAAATCAGGGGG + Intergenic
902818115 1:18927493-18927515 GCAGCAGGGCTGGATGCAGGTGG + Intronic
903057058 1:20643321-20643343 TCAGCAGGGCTGTGGTTTGGGGG + Intronic
905475775 1:38226765-38226787 TTAGCAGGTCTGCTCTCTGGGGG + Intergenic
906078975 1:43071252-43071274 TCAGCAGGGCTGCAGGAAGGTGG + Intergenic
907971972 1:59391994-59392016 TCAGAAGGGTTTCATTCTGAGGG + Intronic
908256720 1:62309138-62309160 CCAGCATGGCTGGGTTCTGGTGG + Intronic
910037391 1:82804633-82804655 GAAGCAAGGCTGCATTCTGTGGG - Intergenic
912066184 1:105746489-105746511 TCAGCAGTGCTGAAGTCTGAGGG + Intergenic
913286987 1:117235704-117235726 TCCGCAGGGCTGCCTTGAGGTGG - Intergenic
916475885 1:165168626-165168648 TCAGCTGAGCTGCATCCTGCAGG - Intergenic
916635583 1:166664580-166664602 CCAGGAGGGGTGCATTTTGGGGG - Intergenic
918431435 1:184464856-184464878 TCAACAGGGCTGGGTCCTGGGGG + Intronic
922842037 1:228650466-228650488 GCAGGAGGGCAGCATCCTGGTGG + Intergenic
923195514 1:231662539-231662561 GCAGCTGTGCTGCATTGTGGGGG + Intronic
1068734183 10:60393239-60393261 TCACCAAAGCTGCCTTCTGGAGG - Intronic
1069076140 10:64040465-64040487 TTAGGAGGAATGCATTCTGGTGG - Intergenic
1069723514 10:70563822-70563844 TCATCAAGGCTACATTCTCGAGG - Intronic
1075979167 10:126722356-126722378 GCACCAGGGTTGCCTTCTGGGGG - Intergenic
1076167055 10:128291195-128291217 TCTGCAGGGCTGCACTCTCTAGG + Intergenic
1076203204 10:128574004-128574026 TCAGCGGGCCTCCTTTCTGGAGG + Intergenic
1077182787 11:1224005-1224027 TCAGCAGGGCTGGAGGCAGGGGG + Intronic
1077842869 11:5994067-5994089 TCAGCAGGGCTTCCTACTCGTGG + Intergenic
1077949461 11:6940342-6940364 TCACCAGGGCTGGAGTGTGGTGG + Intronic
1078086538 11:8236553-8236575 GCTGCAGGGCTGCATGCTGAGGG + Intronic
1078507261 11:11961544-11961566 TCAACAGGGCTGCATTCCTCTGG - Intergenic
1080245401 11:30174373-30174395 TCAGCAGGGCTGGTTTCTTCTGG + Intergenic
1080267858 11:30420372-30420394 TCAGCAGGGCTGCATTTTTTTGG - Intronic
1080734193 11:34994968-34994990 TCCTCAGGCCTGCATTTTGGCGG + Exonic
1082075724 11:47974702-47974724 TCAGCAGAGCTGCCTCCTGGTGG + Intergenic
1082273041 11:50192711-50192733 TCAGCAGAGGAGCCTTCTGGAGG + Intergenic
1084091266 11:66880640-66880662 CCAGAAGGGCTGCAGACTGGTGG - Intronic
1084146666 11:67268625-67268647 TCAGAAGCAATGCATTCTGGGGG - Intronic
1084357696 11:68650962-68650984 TCGGCCGGGCTGCCTTCGGGAGG - Intergenic
1084969732 11:72764589-72764611 GCAGCAGTGCTGCCTGCTGGGGG - Intronic
1085473045 11:76770196-76770218 TCAGCAGGGCTGGCTTCTGGAGG + Intergenic
1086401019 11:86460975-86460997 TCTTCAGGTCTGCATTCTGTAGG + Intronic
1086918407 11:92557628-92557650 GCAGCATGGCTGGATTCAGGTGG - Intronic
1089440449 11:118511735-118511757 CCAGCAGGGCTTCTTTCTGTTGG - Intronic
1089733389 11:120533542-120533564 TCTGCAGAGCTGGATTATGGAGG + Intronic
1090320500 11:125839034-125839056 TCAGCAGGGCTGGTTTCTGGAGG - Exonic
1091368329 11:135039702-135039724 TCCCCAGGGCTGCAGTGTGGGGG + Intergenic
1092094247 12:5828270-5828292 TCAGCCGGGCTCCAGGCTGGGGG - Intronic
1093864648 12:24210365-24210387 TTAGCAGGCATGAATTCTGGAGG - Intergenic
1096183997 12:49566515-49566537 TTAGCACGGCTGCATTTTGATGG - Intronic
1097036747 12:56129255-56129277 TCTGCCGCGCTGCAGTCTGGCGG - Intronic
1097449126 12:59714437-59714459 CCAGTAGGGCTGGTTTCTGGTGG + Intronic
1097455324 12:59792703-59792725 GCAGCTGTGCTGCATTGTGGGGG + Intergenic
1097723023 12:63044312-63044334 TAAGCAGGGCTGAATTATGGAGG - Intergenic
1099318429 12:81113838-81113860 TCAGAAGATCTGCATTCTAGAGG + Intronic
1100120404 12:91363170-91363192 TCAGCAGGGTTGGTTTCTTGAGG + Intergenic
1100385979 12:94104959-94104981 TCAGCAGGGCTCCTTTCAGTAGG + Intergenic
1101734779 12:107454728-107454750 ACCCCAGGGCTGCATGCTGGGGG + Intronic
1102608203 12:114087042-114087064 TTAGCAGGGCAGAATGCTGGAGG - Intergenic
1103216588 12:119206462-119206484 TCATGAGGGCTGCATTCTTATGG - Intronic
1104436912 12:128764044-128764066 TCAGCAGGGCTGGTTTCTCCTGG - Intergenic
1104670067 12:130674433-130674455 AGAGCAGGGCTGCTTCCTGGGGG + Intronic
1106431961 13:29689168-29689190 TCAGCAGGGCTGAATTCCTTTGG - Intergenic
1107989117 13:45801872-45801894 GCAGCAGGGCTGGGTTTTGGTGG + Intronic
1108319275 13:49272028-49272050 GCAGCAGAGCTGCATGCTGATGG + Intronic
1109360804 13:61292821-61292843 TCAGCTGTGCTGCTTGCTGGAGG - Intergenic
1109433426 13:62267111-62267133 TCAGGAGTTCTGCATCCTGGTGG - Intergenic
1112185622 13:97125419-97125441 TCAGCAGGGCAGCACTCCGGGGG + Intergenic
1114636215 14:24188399-24188421 TCAGCACGGCCGCAAACTGGCGG + Exonic
1115385213 14:32789073-32789095 GCAGCCGTGCTGCATTGTGGAGG - Intronic
1117831472 14:59755594-59755616 TCAGCAGGCCCACAGTCTGGAGG + Intronic
1118192783 14:63595178-63595200 CCAGCTGCGCGGCATTCTGGAGG - Intergenic
1118751801 14:68813249-68813271 GCTGCAGGTCTGCTTTCTGGGGG - Intergenic
1119851580 14:77870318-77870340 GCAGAAGGGCTGGTTTCTGGGGG + Intronic
1119866493 14:77979412-77979434 TCTGCAAGGCTGTCTTCTGGAGG + Intergenic
1120837887 14:89057486-89057508 CCAGCAGGCTTCCATTCTGGTGG - Intergenic
1121083084 14:91124410-91124432 TCAGCAGGACTTCAGGCTGGAGG + Intronic
1121255767 14:92529061-92529083 CCAGCCGGCCTGGATTCTGGGGG - Intronic
1122181565 14:99958789-99958811 CCAGTAGGGCTGCATTCTTCTGG - Intergenic
1122274425 14:100584329-100584351 TCAGCAGGCCTTGAGTCTGGAGG - Intronic
1122783534 14:104153691-104153713 TGAGCTGGGCAGCATCCTGGAGG + Intronic
1122795151 14:104202336-104202358 CCAGCACGGCTCCATGCTGGCGG - Intergenic
1123055012 14:105565600-105565622 TCACCCGGGCTGCACCCTGGGGG + Intergenic
1123079461 14:105685444-105685466 TCACCCGGGCTGCACCCTGGGGG + Intergenic
1123448658 15:20346717-20346739 GCAGCAGTCATGCATTCTGGTGG + Intergenic
1124347084 15:28930170-28930192 CTGGCAGGGCTGCATTGTGGTGG + Intronic
1124794959 15:32769061-32769083 TCAGTAGGTCTGCTGTCTGGTGG - Exonic
1127836601 15:62795584-62795606 TCAGAAGGGCTGGAGTCTAGAGG - Intronic
1129225268 15:74166609-74166631 TCAGCAGGGTTGGTTTCTGCAGG + Intergenic
1133312539 16:4859398-4859420 TCAGCAGGGGTCGTTTCTGGAGG + Intronic
1133634722 16:7654065-7654087 GCGGCCGGGCTGCATGCTGGGGG - Intronic
1133693392 16:8237415-8237437 TCAGGTGGCCTGGATTCTGGAGG - Intergenic
1135415423 16:22265045-22265067 TCTGCAGGGCAGGATGCTGGGGG + Intronic
1135546400 16:23369890-23369912 TCACAAGGGCTGCATGATGGAGG - Intronic
1136563158 16:31053119-31053141 TCAGCAGGGCTGGTTTTTGTTGG + Intergenic
1139378652 16:66516517-66516539 TCAGCCGGGCGGCAGCCTGGAGG + Intronic
1141067841 16:80928241-80928263 TCAGCAGCTCTGCATTCCGATGG + Intergenic
1141125405 16:81397475-81397497 TCAGCAGGGCTGCTTCCTCCTGG - Intergenic
1144345548 17:14346071-14346093 TCAACAGGGCTGTATTCTGAAGG + Exonic
1147805769 17:43129947-43129969 TCAGCAGGACTGCGTTTTGGTGG + Intergenic
1148237048 17:45975991-45976013 TCTGCTGCGCTGGATTCTGGTGG + Intronic
1149383974 17:56123950-56123972 TCAGAAGAGATGCCTTCTGGGGG - Intronic
1150090075 17:62316049-62316071 TCAGCAGGGCTGGTTTCTTCAGG - Intergenic
1150478944 17:65495082-65495104 TTGAAAGGGCTGCATTCTGGGGG - Intergenic
1150811024 17:68357305-68357327 TCAGCAGGACTGTTTTCTTGGGG + Intronic
1151018845 17:70589136-70589158 TAAGCAAGGCTGCACTTTGGAGG + Intergenic
1151160302 17:72159337-72159359 TCAGCAGGGCATCTTTCTGATGG - Intergenic
1152253290 17:79222911-79222933 TCCCCCGGGCTCCATTCTGGAGG + Intronic
1152253622 17:79224717-79224739 TTAACAGGGCTGCAGTTTGGAGG + Intronic
1152338892 17:79713629-79713651 TCAGCAGGGCTGGCTTCTTCTGG - Intergenic
1153244493 18:3060555-3060577 TTATCTGGGCTGCATTATGGTGG - Intergenic
1154316044 18:13304084-13304106 GCAGCAGGGCTGCCTCCCGGGGG - Intronic
1154331284 18:13430851-13430873 TCAGCAGGGACACATCCTGGAGG - Intronic
1154472779 18:14721199-14721221 TCAGTAGGGCTGCATTCTCCTGG - Intergenic
1156523040 18:37738018-37738040 TCAGCAGGGCTGCATGCAGTAGG + Intergenic
1156584417 18:38415914-38415936 TCATCAGGACTGGATTCTGGTGG + Intergenic
1158628204 18:59089962-59089984 TCAGCAGGGGTGGCTTCTGCGGG + Intergenic
1163074846 19:14880730-14880752 GCAGCAGGGCTGCTGGCTGGTGG - Exonic
1163453214 19:17391128-17391150 TGCGCAGGGCTGCATTCTTTCGG - Intergenic
1164565525 19:29323509-29323531 GCAGCTGGGCTGAAATCTGGGGG - Intergenic
1164579601 19:29426315-29426337 GCAGCAGGTCTGCATCTTGGGGG - Intergenic
1164769753 19:30799440-30799462 GGAGCAGGTCTGCATTCTGGGGG + Intergenic
1165680661 19:37771938-37771960 TCAGCAGGTCTGAATTATTGTGG - Intronic
1166189397 19:41165866-41165888 TCAGCAGGGCTGGATCCTTCTGG - Intergenic
1166239632 19:41481074-41481096 GCAGCAGTGCTGCCTTGTGGGGG - Intergenic
925712438 2:6754429-6754451 TCTGCAAGGCAGCACTCTGGCGG + Intergenic
925836554 2:7952209-7952231 TGTGCAGGGCTGAAATCTGGCGG - Intergenic
927027946 2:19089657-19089679 CCAGCAAGGCTGCAGCCTGGCGG + Intergenic
928221718 2:29408774-29408796 TGAGAAGGGAGGCATTCTGGAGG + Intronic
928883456 2:36122767-36122789 ACAGCTGTGCTGCATTGTGGGGG + Intergenic
929557098 2:42932281-42932303 TCGGCAGGGCTGCTCTTTGGTGG - Intergenic
930007490 2:46909732-46909754 TCAGCTGGGCTGCAGCCTAGAGG + Intronic
931471247 2:62539717-62539739 TCAGCAGGGCTGGTTTCTCCTGG - Intergenic
932160721 2:69457004-69457026 ACACCTGGGCTGCATTCTGAAGG + Intergenic
933561932 2:83898346-83898368 TTAGCAATGCTGCATTCTGGAGG - Intergenic
934792326 2:97071878-97071900 CATGCTGGGCTGCATTCTGGAGG - Intergenic
934814292 2:97311831-97311853 CATGCTGGGCTGCATTCTGGAGG + Intergenic
934823402 2:97396652-97396674 CATGCTGGGCTGCATTCTGGAGG - Intergenic
934989703 2:98912656-98912678 TCAGCAAGGCTGCAATGGGGAGG - Intronic
935104032 2:100023000-100023022 TTAGCAGGCCTCCATTCTGTGGG + Intronic
935656727 2:105429584-105429606 TCAGCAGGGCTGCATTCTGGAGG - Intronic
936613257 2:114022724-114022746 TCTGCAGGGCAGCAGGCTGGAGG - Intergenic
939053910 2:137339193-137339215 GCAGAAGGGCTGCATTCTAATGG - Intronic
939978489 2:148749017-148749039 TCAGCATGGCTGGAATCAGGTGG - Intronic
941070367 2:160948031-160948053 TGAGCGGGGCTGTATTGTGGTGG - Intergenic
942139073 2:172959216-172959238 TCAGCAGGGCTGCGTTCATCTGG + Intronic
942360588 2:175168006-175168028 TCAGCAGGGCTGGAGACTGTAGG - Intronic
948061193 2:235044370-235044392 TCAGCAGAGCTGGGTCCTGGCGG + Intronic
948702344 2:239768266-239768288 TCAGAAGGGCTCCATGCTCGGGG + Intronic
948704771 2:239782079-239782101 TCAGCAGGGCTGGATTCTTCTGG - Intronic
1170751396 20:19149829-19149851 TCACCCAGGCTGCATTGTGGTGG - Intergenic
1171040629 20:21759172-21759194 TCAGCATGGCTGTTTTCAGGAGG - Intergenic
1172863367 20:38075201-38075223 ACAGCAGGAACGCATTCTGGTGG - Intronic
1174058851 20:47818358-47818380 ACAGAAGGGCTTCATTCTGCAGG + Intergenic
1174072931 20:47911355-47911377 TCAGCAGGGCTGGCTCCTGCTGG + Intergenic
1174556071 20:51396632-51396654 TCAAGAGGGCTGCATTCTCCAGG + Intronic
1175718493 20:61271430-61271452 TCAGCAGGGCTGGATGCTGAGGG - Intronic
1176689232 21:9883289-9883311 TCAGCACAGCTGCCTTATGGAGG - Intergenic
1176801709 21:13436656-13436678 TCAGTAGGGCTGCATTCTCCTGG + Intergenic
1177462609 21:21432493-21432515 TCAGCAGAGTTCAATTCTGGAGG + Intronic
1180202388 21:46232435-46232457 TCAGCTGGGCAGCTTTCTGTTGG - Intergenic
1181030837 22:20148282-20148304 GCAGAGGGGCTGCCTTCTGGAGG + Intergenic
1181512489 22:23395105-23395127 GCAGAGGGGCTGCCTTCTGGAGG - Intergenic
1182194874 22:28505996-28506018 GCAGCTGGGCTGCACTGTGGGGG - Intronic
1182329025 22:29537237-29537259 CCATCAGTGCTGCATTCTTGTGG - Intronic
1182584310 22:31335118-31335140 TGAGCAGGGCAGCATGCTTGAGG - Intronic
1183498404 22:38163490-38163512 TCAGGAGCCCTGCAGTCTGGAGG + Intronic
1184029066 22:41880519-41880541 TCAGCAGGGATTCTTCCTGGGGG + Intronic
1184653872 22:45931644-45931666 TCGGCAGCACTGCATGCTGGAGG - Intronic
1184687869 22:46104581-46104603 TCAGCAGGGCTGCCTCAGGGTGG - Intronic
1184778043 22:46633082-46633104 TGGGCAGGGCTGCTTCCTGGAGG - Intronic
949307113 3:2654604-2654626 TGAGCAGGGCTGAATGCTTGTGG - Intronic
949485912 3:4537745-4537767 TCAGCAGGGCTGCATTCCTCTGG - Intronic
950687366 3:14628084-14628106 TGGGCAGGGATGGATTCTGGAGG + Intergenic
953410960 3:42690306-42690328 TCAGCAGGGCTGTGTGCTGTAGG + Intronic
953503594 3:43461812-43461834 TCAGCAGCGCCCCATTCTGCTGG - Intronic
953704275 3:45219616-45219638 TCACCAAGGCTCCATTCTGCGGG - Intergenic
954623745 3:52010846-52010868 TCAGCAGGGTTGCATTCTGGAGG - Intergenic
956750801 3:72342449-72342471 ACAGCAGGTCTGCATTCCGAAGG + Intergenic
956964937 3:74447938-74447960 TAAGCTGGGCTGCATCCTGATGG - Intronic
959405551 3:105958415-105958437 CCAGCAGGGCTGGTTTCCGGTGG + Intergenic
962032968 3:131620827-131620849 TCAGCAGAGCTGCATTCCTCTGG - Intronic
962984405 3:140521649-140521671 GCAGCTGTGCTGCATTGTGGGGG + Intronic
963545841 3:146657860-146657882 GCAGCAGGGCATCATTTTGGGGG + Intergenic
964308262 3:155363397-155363419 TCGGCATGCATGCATTCTGGAGG - Intergenic
965095054 3:164215730-164215752 TGAGCAGGGCTGGGTTATGGGGG - Intergenic
966009077 3:175053466-175053488 TCAGCATGGCTGCAACCAGGGGG + Intronic
969109242 4:4831508-4831530 CCAGCAGGGCTGGCTCCTGGTGG - Intergenic
969719166 4:8883588-8883610 TCAGCAGGGCTGCACTCCACGGG + Intergenic
972733698 4:41819383-41819405 TTAGCAGGGGTGCACTCTGGGGG + Intergenic
975248023 4:72142880-72142902 TCAGGAAGGCTACAATCTGGCGG + Intronic
975526952 4:75361424-75361446 TGAGTAGGGCTGTATTGTGGTGG - Intergenic
975705243 4:77105232-77105254 ACAGCAGGGCTGCATTCACTTGG - Intergenic
979709531 4:123761896-123761918 TCAGTATGGCTGGCTTCTGGAGG - Intergenic
980352616 4:131701105-131701127 TCAGCACAGCTGCCTTATGGAGG - Intergenic
981912458 4:149997348-149997370 TTAGTAGGGCTGCATTCTTCTGG - Intergenic
982578284 4:157145848-157145870 TCATCTGGGCTGCATTCCTGAGG + Intronic
983484794 4:168320479-168320501 TTATCAGGGCTGATTTCTGGAGG - Intergenic
984423549 4:179554800-179554822 TCAGCAGGGCTACATTCCCTGGG - Intergenic
984926675 4:184813187-184813209 ACAGCAGGGCTAAATTTTGGCGG + Intronic
986405549 5:7421319-7421341 TCAGCAGGGCTGTATTCTTTTGG + Intronic
986572253 5:9177474-9177496 TTTGGAGGGCTTCATTCTGGTGG + Intronic
986753559 5:10812369-10812391 GCAGCTGTGCTGCATTGTGGGGG - Intergenic
988350566 5:30100923-30100945 TCAGCAGGGCTGGTTTCTTCAGG + Intergenic
988394339 5:30678491-30678513 TCAGCAGTGCTCCATTCTACTGG - Intergenic
988540262 5:32102194-32102216 TAAGCAGCGCTGCATCCTTGGGG + Intronic
988849578 5:35165838-35165860 TCAGCAGAACTGAATTCTGCTGG + Intronic
989156066 5:38346106-38346128 TCAGCTTGGGTGCATTCTGAGGG - Intronic
989667667 5:43874753-43874775 ACAGTTGGGCTCCATTCTGGTGG + Intergenic
991945356 5:71894017-71894039 TCAGCAGGTCTGAATTGTGGTGG - Intergenic
992401010 5:76411527-76411549 TCAGGAGGGCAGAACTCTGGTGG - Intronic
992634891 5:78717897-78717919 TCAGCAGAGCAGCTTTGTGGGGG - Intronic
993072748 5:83186838-83186860 TCAGTAGGGCTGTGTTCTGGAGG + Intronic
997719401 5:136065760-136065782 TCATTAGGGCTGCCATCTGGAGG + Intergenic
997956844 5:138285508-138285530 TCAGCAGAGCTGAAAGCTGGTGG - Exonic
998877979 5:146619517-146619539 TCTGCATGGCTGCATTCAGCCGG - Intronic
999326575 5:150648002-150648024 TCAGCTGGGCTGCAATCTGCTGG - Exonic
1000934267 5:167289013-167289035 TCAGCAGGGCTGGGAGCTGGTGG - Intronic
1001186799 5:169581908-169581930 TAAGGAGGGGTGCATTCTAGGGG - Intergenic
1001298250 5:170514366-170514388 TCAGCAGGGGTGTCTTCAGGAGG + Intronic
1002565317 5:180109822-180109844 TCAGCAGGGCTGGTTTCTTCTGG - Intronic
1003121047 6:3319233-3319255 TCAGCAGGGCTGGAGCATGGTGG - Intronic
1003507184 6:6749851-6749873 TCAGCAAGGCTGGGTGCTGGAGG + Intergenic
1004053457 6:12111460-12111482 TCAGCAGGTCTGTCTTCTGGAGG + Intronic
1004804957 6:19193476-19193498 AGAGCAAGGCAGCATTCTGGTGG - Intergenic
1005917950 6:30370603-30370625 TCATCAGGGCTGCATTCCTATGG + Intergenic
1006550832 6:34821853-34821875 CCAGTAGGCCTGCTTTCTGGAGG + Intronic
1006983353 6:38162674-38162696 GCAGCAAGGCTGCATTAGGGTGG - Intergenic
1007273793 6:40658690-40658712 GCAGTGGGGCTGCATCCTGGGGG - Intergenic
1007889188 6:45270690-45270712 TCAGCAGTGCCCCACTCTGGTGG - Intronic
1010700446 6:79038368-79038390 TCACAAGGGCTCCATTCTTGAGG + Intronic
1013926647 6:115480803-115480825 CCTGCAAGGCTGCATACTGGTGG - Intergenic
1014117722 6:117685137-117685159 ACAGCAGGTATGCATTTTGGGGG - Intronic
1014619032 6:123642873-123642895 TCTGCAGGGGTACATTCAGGTGG - Intergenic
1014978251 6:127915945-127915967 TCACCAAGGCTGGATTGTGGTGG - Intronic
1015053688 6:128874456-128874478 TCAGCAGTGCTGCACTCTACTGG - Intergenic
1015842435 6:137489311-137489333 CCAGCGGGGCTGCACTCGGGAGG + Intergenic
1016723219 6:147327167-147327189 TGAGCAGCACTGCTTTCTGGAGG - Exonic
1018670444 6:166172565-166172587 TCTGCAGGGCTGCACTCTCAGGG + Intergenic
1019045101 6:169139675-169139697 CCAGCAGGGCTGGAGCCTGGCGG - Intergenic
1020361855 7:7335334-7335356 TCAACAAGGTAGCATTCTGGAGG - Intergenic
1020639170 7:10734264-10734286 TCAGCAGGGTTGGTTTCTGACGG + Intergenic
1020680807 7:11234373-11234395 TCAGCTGTGCTGAATTCTGGAGG + Intergenic
1020936628 7:14473511-14473533 CCAGTAGGGATGCATTGTGGGGG - Intronic
1021316544 7:19155329-19155351 TCAGGAGTGCTGCAATTTGGGGG + Intergenic
1021674472 7:23066150-23066172 TCAAGATGACTGCATTCTGGAGG + Intergenic
1026139635 7:67694614-67694636 TCTACATGGCTGCATTCTGGGGG + Intergenic
1026443747 7:70465861-70465883 CCAGCAAGGCTGCTTGCTGGGGG + Intronic
1026899081 7:74027435-74027457 TGGACAGGGCTGCATTCTGCAGG - Intergenic
1027702168 7:81483270-81483292 TCAGGATGGCTGCAATATGGCGG + Intergenic
1030780498 7:113593770-113593792 CCAGCTGGGCTCCATTCTGGTGG + Intergenic
1031123148 7:117743720-117743742 TCACCAGGGCTGGAGTGTGGTGG - Intronic
1031380417 7:121078920-121078942 TCAGCAGAGCTGCTTTCTTCTGG + Intronic
1031501126 7:122517800-122517822 TCAGAAGGGCTGGAATGTGGAGG + Intronic
1031820982 7:126501256-126501278 GGAGCAGGGCTTCATTATGGAGG + Intronic
1032465439 7:132141513-132141535 TCAAGAAGCCTGCATTCTGGTGG + Intronic
1033170446 7:139079183-139079205 GCAACAGAGCTGCAGTCTGGGGG - Intronic
1033431630 7:141294855-141294877 TCAGCTGTGCTACATCCTGGTGG + Intronic
1033679706 7:143582659-143582681 TCAGCTGGACAGCATTATGGTGG - Intergenic
1033692129 7:143746784-143746806 TCAGCTGGACAGCATTATGGTGG + Intergenic
1033856512 7:145568078-145568100 TCAGCAGGGCTCCTTTCTGGAGG + Intergenic
1034847332 7:154458507-154458529 TCAGCAGGGCTGCACGCTCTTGG - Intronic
1035206987 7:157300192-157300214 TTCGCAGGGCTGCAGACTGGAGG - Intergenic
1035233076 7:157477877-157477899 GAGGCAGGGCTGCATCCTGGTGG + Intergenic
1036562346 8:9907391-9907413 TCAGCAGGGCTGCTTTTAGCTGG - Intergenic
1036765755 8:11548368-11548390 TCAGGAGGGCTGCATGGAGGCGG - Intronic
1036830042 8:12014390-12014412 TCTGCTGGGCTGCAGGCTGGTGG - Intronic
1038312194 8:26453238-26453260 TCAGGTGGGCAGCATGCTGGCGG + Intronic
1040060562 8:43099993-43100015 TAAGCGAGGCTGCATACTGGCGG + Intronic
1041200915 8:55451549-55451571 GCAGTACTGCTGCATTCTGGGGG - Intronic
1041709137 8:60876938-60876960 TCAGCAGGGTTGGCTTCTTGGGG - Intergenic
1042313998 8:67406315-67406337 TCAGCAGAGCTACATGCTGATGG - Intergenic
1044113338 8:88303426-88303448 ACAGCTGTGCTGCATTGTGGGGG - Intronic
1048307684 8:133295536-133295558 TTGGAAGGGCTGCCTTCTGGTGG - Intronic
1049202717 8:141349801-141349823 TTACCTGGGCTGTATTCTGGAGG + Intergenic
1050170556 9:2811374-2811396 GCAACAGGACTGCATCCTGGTGG - Exonic
1051117812 9:13717128-13717150 TCCTTATGGCTGCATTCTGGAGG - Intergenic
1051868155 9:21705831-21705853 TCAGCAGGACTGCCTGCTGCTGG + Intergenic
1052152297 9:25131937-25131959 TCACCAGGGCAGCATCCTAGAGG + Intergenic
1052835296 9:33245756-33245778 TAAGCGGGGCTGGATTCTGATGG - Intronic
1052998799 9:34565994-34566016 TCAGCAGGGTGGCTCTCTGGAGG - Intronic
1058514067 9:105751795-105751817 GCAGCTGTGCTGCATTGTGGGGG - Intronic
1058766627 9:108188431-108188453 TAAGCAGGCCTGGATTGTGGGGG + Intergenic
1060668292 9:125446636-125446658 TCAGCAGGAATGCCTCCTGGAGG - Intronic
1061449945 9:130662491-130662513 TCAGCAGCGCTGCCCTCTGCTGG + Intergenic
1061487618 9:130928417-130928439 TCAGCAGGGCTGGGGGCTGGGGG - Intronic
1061701771 9:132421564-132421586 TCAGCGGGGCTGGAGTTTGGAGG + Intronic
1062480306 9:136747954-136747976 GCTGCAGGGCTGCAGGCTGGAGG - Intronic
1185855995 X:3535812-3535834 TCAGCAGGGCTGCTGTCTTTGGG + Intergenic
1185922429 X:4108294-4108316 TCAGCAGGGCTGCTTCCTTCTGG - Intergenic
1186279946 X:7981289-7981311 TAAGAAGGGCACCATTCTGGTGG - Intergenic
1188525705 X:31085609-31085631 TCAGCAGGGCTGCAGTCATCTGG - Intergenic
1188895959 X:35668624-35668646 TGAGCAGGGCTGGCTTATGGGGG + Intergenic
1191815612 X:65241343-65241365 GCAGCTGTGCTGCATTGTGGGGG + Intergenic
1194623034 X:96196634-96196656 GCAGCTGTGCTGCATTGTGGGGG - Intergenic
1197522659 X:127519570-127519592 GCAGCTGTGCTGCATTGTGGGGG - Intergenic
1200162213 X:154015381-154015403 TCAGCGGGGCTGAATCCTGACGG + Intronic
1200355026 X:155539680-155539702 TCTGTAGGGGTGCTTTCTGGAGG - Intronic
1200968139 Y:9120207-9120229 ACTGCAGGGCAGCATCCTGGGGG + Intergenic