ID: 935656730

View in Genome Browser
Species Human (GRCh38)
Location 2:105429598-105429620
Sequence CCCTGCTGATACCTTGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2340
Summary {0: 1, 1: 15, 2: 160, 3: 624, 4: 1540}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935656727_935656730 -9 Left 935656727 2:105429584-105429606 CCTCCAGAATGCAGCCCTGCTGA 0: 1
1: 1
2: 3
3: 25
4: 266
Right 935656730 2:105429598-105429620 CCCTGCTGATACCTTGATTCTGG 0: 1
1: 15
2: 160
3: 624
4: 1540
935656726_935656730 3 Left 935656726 2:105429572-105429594 CCTTCTCTAGAGCCTCCAGAATG 0: 1
1: 3
2: 12
3: 83
4: 363
Right 935656730 2:105429598-105429620 CCCTGCTGATACCTTGATTCTGG 0: 1
1: 15
2: 160
3: 624
4: 1540

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935656730 Original CRISPR CCCTGCTGATACCTTGATTC TGG Intronic
Too many off-targets to display for this crispr