ID: 935657861

View in Genome Browser
Species Human (GRCh38)
Location 2:105440147-105440169
Sequence GGATGTGCCACAAATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 158}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935657851_935657861 10 Left 935657851 2:105440114-105440136 CCCCCCTCCCACACACACACATA 0: 1
1: 35
2: 430
3: 2045
4: 11750
Right 935657861 2:105440147-105440169 GGATGTGCCACAAATGTGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 158
935657855_935657861 6 Left 935657855 2:105440118-105440140 CCTCCCACACACACACATACATC 0: 2
1: 11
2: 157
3: 1386
4: 10083
Right 935657861 2:105440147-105440169 GGATGTGCCACAAATGTGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 158
935657854_935657861 7 Left 935657854 2:105440117-105440139 CCCTCCCACACACACACATACAT 0: 1
1: 9
2: 162
3: 2075
4: 9957
Right 935657861 2:105440147-105440169 GGATGTGCCACAAATGTGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 158
935657853_935657861 8 Left 935657853 2:105440116-105440138 CCCCTCCCACACACACACATACA 0: 1
1: 41
2: 592
3: 7235
4: 14546
Right 935657861 2:105440147-105440169 GGATGTGCCACAAATGTGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 158
935657857_935657861 2 Left 935657857 2:105440122-105440144 CCACACACACACATACATCCTGA 0: 1
1: 2
2: 9
3: 173
4: 1359
Right 935657861 2:105440147-105440169 GGATGTGCCACAAATGTGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 158
935657852_935657861 9 Left 935657852 2:105440115-105440137 CCCCCTCCCACACACACACATAC 0: 1
1: 27
2: 376
3: 2775
4: 12060
Right 935657861 2:105440147-105440169 GGATGTGCCACAAATGTGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 158
935657856_935657861 3 Left 935657856 2:105440121-105440143 CCCACACACACACATACATCCTG 0: 1
1: 3
2: 10
3: 174
4: 1375
Right 935657861 2:105440147-105440169 GGATGTGCCACAAATGTGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935657861 Original CRISPR GGATGTGCCACAAATGTGGA AGG Intergenic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
901821163 1:11830296-11830318 GCAGGACCCACAAATGTGGATGG - Intronic
903138763 1:21326239-21326261 GGAGGGGCCACAAATGGGGAGGG + Intronic
904743700 1:32697797-32697819 GGATATGACACAAATGAAGAGGG - Intronic
904836552 1:33341293-33341315 GGGTGGGCCACACAGGTGGAGGG + Intronic
905507870 1:38494482-38494504 GGGTGTGGCACACCTGTGGAGGG - Intergenic
905532594 1:38693888-38693910 GAATGTGGCACAGAGGTGGATGG - Intergenic
907849957 1:58247080-58247102 AGATGTGTCACATCTGTGGAAGG + Intronic
907869680 1:58432015-58432037 GGGTTTGGAACAAATGTGGAAGG + Intronic
911923123 1:103792647-103792669 GCATGTGCAAGAAATGTGGATGG + Intergenic
912944117 1:114070419-114070441 GGATGTGGGACAATGGTGGAAGG - Intergenic
919992156 1:202715560-202715582 GGATGTGCCCTAGCTGTGGAAGG + Intergenic
920210968 1:204327883-204327905 GGATATGCCTCAAATGGGAAAGG - Intronic
921616846 1:217278652-217278674 GTATGAGACACAAAAGTGGAAGG + Intergenic
923144524 1:231188544-231188566 GGATGTTCAACCAACGTGGAAGG - Intronic
924370120 1:243338883-243338905 GGCTCTGCAACAGATGTGGATGG + Intronic
1069997402 10:72351153-72351175 GGCTTTGTAACAAATGTGGAAGG - Intronic
1070330769 10:75415408-75415430 GGACCTGCCACCAATGTGGCAGG + Intergenic
1071816556 10:89238159-89238181 GGATATGGCAAAAAGGTGGAGGG + Intronic
1074871655 10:117581740-117581762 GTATGTGTCACAAGTGTGGGAGG + Intergenic
1075245796 10:120821271-120821293 GGCTATGGGACAAATGTGGAAGG - Intergenic
1075420318 10:122295531-122295553 GGATGTGGTATAAATGTGGGAGG + Intronic
1077522692 11:3045682-3045704 GGATGTCCAACAGAGGTGGAAGG + Intronic
1084180102 11:67441850-67441872 GGATCTGCCACACCTGTGGTAGG + Exonic
1084597329 11:70124730-70124752 AGAGCTGCCTCAAATGTGGAAGG + Intronic
1085744986 11:79107413-79107435 GGATGTGCCACAGAGGTGGGTGG - Intronic
1087053410 11:93908385-93908407 GCATGAGGCACCAATGTGGATGG + Intergenic
1088739577 11:112756191-112756213 GCATTTGCCATAAATGTGGGAGG - Intergenic
1090147289 11:124339139-124339161 GGATGTCACACAAATAGGGATGG + Intergenic
1091428535 12:412797-412819 GGGTATGGCACAGATGTGGAAGG - Intronic
1092852493 12:12643127-12643149 GGATATGCCTCCACTGTGGAGGG + Exonic
1093797466 12:23329959-23329981 GGAAGAGCCCCAAATGTAGAAGG + Intergenic
1095045386 12:37497757-37497779 AGAGATGCCAGAAATGTGGATGG - Intergenic
1095860845 12:46916600-46916622 GAATTTGGCACAAATATGGATGG + Intergenic
1097564623 12:61252213-61252235 GGATGTGGCTCAAATGTCCATGG - Intergenic
1102762652 12:115402082-115402104 GGGTGTACCAGAAATGTGGTTGG - Intergenic
1103020283 12:117528451-117528473 GGAGGTCCCCCAAATGAGGATGG - Intronic
1103310187 12:120000096-120000118 AGAAGTGCCACCAATGGGGAAGG + Intronic
1106021806 13:25922779-25922801 AGATGAGCAACAAATGTGTAGGG - Intronic
1110146408 13:72196405-72196427 GGAAGATCCAGAAATGTGGAGGG - Intergenic
1110268614 13:73568227-73568249 GGATGGGCAGCAAATGAGGAAGG - Intergenic
1111914441 13:94346384-94346406 TGATGTTCCACTCATGTGGATGG + Intronic
1114243852 14:20894266-20894288 GTATGTGCCACAAAAGTGACAGG + Intergenic
1117446494 14:55808234-55808256 GAATGTGTCACAGATGTGCATGG + Intergenic
1117907625 14:60606669-60606691 GGATGTGCCTAGAATCTGGAAGG - Intergenic
1118377067 14:65186812-65186834 AGATGTGGGACAAATGTTGAGGG + Intergenic
1122705271 14:103616968-103616990 ATATGTGCCCAAAATGTGGAGGG - Intronic
1125326098 15:38537419-38537441 GGAAGTGCCACACATCTGGCTGG + Intronic
1135119204 16:19750943-19750965 GGTGGTGTCAGAAATGTGGAGGG + Intronic
1138973388 16:62173258-62173280 GGATTTCCAACAAATGGGGAGGG + Intergenic
1142931421 17:3287242-3287264 GGATGTATCAGAAATGTGGGTGG - Intergenic
1147512347 17:41081771-41081793 GGATGTGCCCGACATGGGGAAGG - Intergenic
1147514520 17:41102942-41102964 GGATGTGCCCGACATGGGGAAGG - Intronic
1148200361 17:45746256-45746278 GGCTGGGGCACAACTGTGGAGGG + Intergenic
1148785405 17:50143829-50143851 GGATGTCCCACAACTGAAGAAGG + Intronic
1149275626 17:55031778-55031800 GGAAAAGCCACATATGTGGAGGG - Intronic
1149505328 17:57189414-57189436 GGACCTGCTACAAATGTGGACGG - Intergenic
1150850752 17:68701681-68701703 GCATATGCCACACATGTGGAGGG + Intergenic
1150947846 17:69766224-69766246 GGATGTGGCACATATGTACAGGG + Intergenic
1151140986 17:71992145-71992167 GGCTGTGCTGCAAATGTGCATGG + Intergenic
1152912818 17:83015057-83015079 GGACCTGCCACCACTGTGGAGGG + Intronic
1152912828 17:83015095-83015117 GGACCTGCCACCACTGTGGAGGG + Intronic
1152912839 17:83015134-83015156 GGACCTGCCACCACTGTGGAGGG + Intronic
1152912849 17:83015172-83015194 GGACCTGCCACCACTGTGGAGGG + Intronic
1152912860 17:83015211-83015233 GGACCTGCCACCACTGTGGAGGG + Intronic
1152912870 17:83015249-83015271 GGACCTGCCACCACTGTGGAGGG + Intronic
1154271622 18:12925422-12925444 GGATGAGCCTCAAAGGAGGAAGG + Intronic
1154499177 18:14986448-14986470 GCTGGTGCCACAAATGTGGTGGG + Intergenic
1157189467 18:45568447-45568469 CCATGTGCCTCAAATGGGGAGGG - Intronic
1158120676 18:54045089-54045111 GGATGTTCCACAAGTATGGGTGG - Intergenic
1158896481 18:61918810-61918832 GGCTTTGCTACAAATGTGCAGGG + Intergenic
1158999979 18:62964928-62964950 CTATGTGACACAATTGTGGAAGG - Intronic
1160132216 18:76235876-76235898 TGATGTGCCACAAAACTGGGTGG + Intergenic
1167526769 19:49989126-49989148 GGATGTGGCAGGCATGTGGACGG + Intronic
1167702569 19:51058831-51058853 GGAAGTGACAGAAATATGGAGGG + Intronic
925076138 2:1017861-1017883 GGGTGTTCTACAAATGCGGATGG + Intronic
933246135 2:79976795-79976817 GGCTGTGCCCCAAGTGGGGAAGG - Intronic
935143985 2:100381439-100381461 GGAAGTGCAACAAATGAGGGAGG - Intergenic
935613884 2:105055626-105055648 TCAGGTGCCACAAAGGTGGAGGG - Intronic
935657861 2:105440147-105440169 GGATGTGCCACAAATGTGGAAGG + Intergenic
939241334 2:139563946-139563968 GAATGTCCCACATAAGTGGATGG - Intergenic
947201115 2:227615484-227615506 TGATGTGCTTCAAATGAGGAGGG - Intronic
947484924 2:230539289-230539311 AGGTGTGCAACAAATGGGGACGG + Exonic
1169117624 20:3076135-3076157 AGACGTCCCACAAATGTGGCAGG - Intergenic
1170596510 20:17809946-17809968 GGATTTGCCTGGAATGTGGATGG + Intergenic
1172971038 20:38873163-38873185 TGATGAGTGACAAATGTGGACGG + Intronic
1173745761 20:45435773-45435795 GGAGGTGGCAGGAATGTGGAGGG + Intergenic
1173980562 20:47220607-47220629 GGATATGGCAAAAATCTGGAGGG - Intronic
1177215232 21:18119504-18119526 GAATGTGCCACAAAGGAAGAGGG + Intronic
1180049650 21:45325370-45325392 GGCTGGGCCACAGGTGTGGACGG - Intergenic
1180722134 22:17917384-17917406 GGATGTGACAGAAATGCAGACGG - Intronic
1181317215 22:21978540-21978562 GGAGGTGGCAGCAATGTGGAAGG + Intronic
1183087152 22:35493435-35493457 CGATCTGCCACTAATGTGCAAGG - Intergenic
1183971680 22:41482187-41482209 GGATGAGCCACAAATCTCCAGGG - Intronic
951785698 3:26416426-26416448 GGCTGGAGCACAAATGTGGAAGG + Intergenic
953369273 3:42373367-42373389 TGATCTGCTACAAATGTGGCTGG - Intergenic
955534864 3:59912185-59912207 GGAGATACCTCAAATGTGGAGGG - Intronic
958881076 3:99670910-99670932 GAATGTGCTACAACTGGGGAAGG - Intronic
959242755 3:103819132-103819154 GGAAGTGCCAAAAACTTGGAAGG - Intergenic
960143465 3:114173506-114173528 GACTGTGCCATAAATGTGTAGGG + Intronic
961009447 3:123426008-123426030 GGGTCTGTCCCAAATGTGGATGG - Intronic
961168629 3:124780342-124780364 GGATGGGGCAGAAATGAGGAGGG + Intronic
961664239 3:128486321-128486343 GGCTGTGCAACAAGTGTGGGCGG + Exonic
965316725 3:167200815-167200837 AAGTGTGCCACAAAAGTGGAAGG + Intergenic
966542216 3:181104986-181105008 AGAACTGCCACTAATGTGGATGG - Intergenic
971791060 4:31170416-31170438 GGATGAGGCACAAATGGGGAAGG - Intergenic
973846248 4:54916026-54916048 GGATGCTCCACAGATATGGAAGG - Intergenic
973950411 4:56007383-56007405 GGATGTCCCAGCAGTGTGGAAGG + Intronic
974057890 4:57002758-57002780 GGATGAGACACAAATGAGAAGGG + Intronic
977833249 4:101617940-101617962 GGAAGTGGCTCAAATGTGCATGG - Intronic
981026665 4:140083628-140083650 GGAGTTGCCAGAAAAGTGGATGG - Intronic
983271561 4:165568147-165568169 AAATCTGCCTCAAATGTGGAGGG + Intergenic
987276742 5:16371096-16371118 AGATTTCCCACAATTGTGGAAGG + Intergenic
989299126 5:39868116-39868138 GGATGTGTCACCAATTTGTAAGG + Intergenic
989734350 5:44685614-44685636 GGATATGCCAGACATGTGGCTGG - Intergenic
992114388 5:73525421-73525443 GTTTGTGCCTCACATGTGGAAGG + Intergenic
995400592 5:111736702-111736724 GGATGTGCTACAAATGTCACTGG - Intronic
995662010 5:114495418-114495440 GGATGTAGCAGAAATGTTGAGGG - Intronic
996021162 5:118592249-118592271 GGGAGTGACACAGATGTGGATGG - Intergenic
996097390 5:119413255-119413277 GGATGTGCCACATCAGTAGAAGG - Intergenic
997923394 5:138004556-138004578 GTAGGTGGCACAAATATGGAAGG + Intronic
997972955 5:138419312-138419334 GCATGTTTCATAAATGTGGATGG - Intronic
1001276496 5:170355206-170355228 GGCTGAGCCCCCAATGTGGAGGG + Intronic
1003153197 6:3570108-3570130 GGATCTGCAGCAGATGTGGAGGG - Intergenic
1003326329 6:5094082-5094104 GAATGAGCCACTATTGTGGATGG + Intergenic
1003758634 6:9150311-9150333 GGAAGTGGCACAAATGTCCATGG + Intergenic
1003934535 6:10961684-10961706 GGAGGTGCCACAGAAGTGGCCGG - Intronic
1004355825 6:14929164-14929186 GGATGTGGCACACATTTTGAAGG - Intergenic
1011049516 6:83129050-83129072 GGATGTGCTACCAATTGGGATGG - Exonic
1011768332 6:90648700-90648722 AGATATGACACAAATGTGGGAGG + Intergenic
1013937675 6:115617678-115617700 GGATTTCTGACAAATGTGGAAGG + Intergenic
1014094380 6:117444445-117444467 GGATGTTCCAAAAATGTTCATGG + Intronic
1015224069 6:130836421-130836443 AGCTGAGCCACAAATGTGGCTGG - Exonic
1015665597 6:135624976-135624998 GGATGGGGCCCAAATGTGAAGGG + Intergenic
1021148369 7:17117962-17117984 GGATCTGCCAATGATGTGGAAGG + Intergenic
1022667164 7:32422220-32422242 GCAGGTGCTACAAATGTTGAAGG + Intergenic
1023052738 7:36267372-36267394 GGCTGTGGCACAGATGTGGAGGG - Intronic
1025291376 7:57727595-57727617 AGAGATGCCAGAAATGTGGATGG - Intergenic
1026736480 7:72952158-72952180 AGATATCCCACAGATGTGGAGGG + Intergenic
1027107254 7:75412904-75412926 AGATATCCCACAGATGTGGAGGG - Intergenic
1028018514 7:85743569-85743591 ATAGGTGCTACAAATGTGGAAGG - Intergenic
1036680364 8:10868019-10868041 GGATGTGCCATTCATGAGGAAGG + Intergenic
1038691142 8:29764789-29764811 GGATGGGACACAAATCTGGAAGG - Intergenic
1041550712 8:59097582-59097604 GAATGTGCCACAGATGAGAAAGG - Intronic
1045749391 8:105464157-105464179 GGATGGGCCATAAAACTGGAAGG - Intronic
1046283083 8:112059209-112059231 GGATGTGGCACCAGTGGGGATGG + Intergenic
1050855720 9:10351867-10351889 GGATGGGTCACAAATGGAGATGG + Intronic
1054838395 9:69706033-69706055 GGGTATGCCACACATGTGTAGGG - Intergenic
1057316051 9:93969184-93969206 GAATGTGCTCCAACTGTGGATGG - Intergenic
1059525256 9:114985363-114985385 GGAAGTGCCAAAGAGGTGGAAGG + Intergenic
1060848425 9:126855897-126855919 GGATTCCCTACAAATGTGGAAGG + Intergenic
1060886963 9:127161218-127161240 GGGTTTGCCACAACCGTGGATGG - Intronic
1062303522 9:135889066-135889088 GGATGTGACACAGATTTAGAGGG - Intronic
1185568850 X:1117144-1117166 GGATGTGCCACCACGATGGATGG + Intergenic
1185626962 X:1489233-1489255 AGATTCCCCACAAATGTGGAGGG + Intronic
1185626978 X:1489365-1489387 GGATTCCTCACAAATGTGGAGGG + Intronic
1185626990 X:1489499-1489521 GGATTCCTCACAAATGTGGAGGG + Intronic
1185627040 X:1489849-1489871 GGATTCTCCACAAATGTGGAGGG + Intronic
1185627073 X:1490064-1490086 GGATTCTCCACAAATGTGGAGGG + Intronic
1185627106 X:1490283-1490305 GGATTCTCCACAAATGTGGAGGG + Intronic
1185627135 X:1490502-1490524 GGATTCTCCACAAATGTGGAGGG + Intronic
1185627155 X:1490633-1490655 GGATTCTCCACAAATGTGGAGGG + Intronic
1185627224 X:1491120-1491142 GGATTCTCCACAAATGTGGAGGG + Intronic
1185627254 X:1491339-1491361 GGATTCCCCACAAATGTGAAGGG + Intronic
1188538803 X:31226723-31226745 GGATGTTGCACCAATCTGGAGGG - Intronic
1189153775 X:38734133-38734155 GTATGTGCCACAAGTGGGTATGG + Intergenic
1190133396 X:47771924-47771946 GGAGGTGCTACAAACGTGGTGGG - Intergenic
1190651102 X:52569616-52569638 GGATGTCCCAAATATTTGGAAGG - Intergenic
1195177232 X:102322895-102322917 GGATGTGGCAGGAATGGGGAGGG - Intronic
1195181632 X:102364198-102364220 GGATGTGGCAGGAATGGGGAGGG + Intronic
1197641198 X:128970205-128970227 GGTTGTGGATCAAATGTGGATGG - Intergenic
1200168204 X:154051929-154051951 GAATGTGCCACATCTGTGGGAGG - Intronic
1200291480 X:154879352-154879374 GTATGTACCTCAAATATGGATGG + Intronic