ID: 935661586

View in Genome Browser
Species Human (GRCh38)
Location 2:105471255-105471277
Sequence CTAGAGAACCAGAGAAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935661586_935661587 15 Left 935661586 2:105471255-105471277 CCAAGCTTTCTCTGGTTCTCTAG No data
Right 935661587 2:105471293-105471315 AACCAAGTCGCATGTTCTGTAGG No data
935661586_935661589 19 Left 935661586 2:105471255-105471277 CCAAGCTTTCTCTGGTTCTCTAG No data
Right 935661589 2:105471297-105471319 AAGTCGCATGTTCTGTAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935661586 Original CRISPR CTAGAGAACCAGAGAAAGCT TGG (reversed) Intergenic
No off target data available for this crispr