ID: 935661587

View in Genome Browser
Species Human (GRCh38)
Location 2:105471293-105471315
Sequence AACCAAGTCGCATGTTCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935661586_935661587 15 Left 935661586 2:105471255-105471277 CCAAGCTTTCTCTGGTTCTCTAG No data
Right 935661587 2:105471293-105471315 AACCAAGTCGCATGTTCTGTAGG No data
935661585_935661587 16 Left 935661585 2:105471254-105471276 CCCAAGCTTTCTCTGGTTCTCTA No data
Right 935661587 2:105471293-105471315 AACCAAGTCGCATGTTCTGTAGG No data
935661584_935661587 17 Left 935661584 2:105471253-105471275 CCCCAAGCTTTCTCTGGTTCTCT No data
Right 935661587 2:105471293-105471315 AACCAAGTCGCATGTTCTGTAGG No data
935661583_935661587 18 Left 935661583 2:105471252-105471274 CCCCCAAGCTTTCTCTGGTTCTC No data
Right 935661587 2:105471293-105471315 AACCAAGTCGCATGTTCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935661587 Original CRISPR AACCAAGTCGCATGTTCTGT AGG Intergenic
No off target data available for this crispr