ID: 935666845

View in Genome Browser
Species Human (GRCh38)
Location 2:105519580-105519602
Sequence AGGGAACCTGCGGTCTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935666845_935666850 6 Left 935666845 2:105519580-105519602 CCTTCACAGACCGCAGGTTCCCT No data
Right 935666850 2:105519609-105519631 CGTATCTATAAAAAACTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935666845 Original CRISPR AGGGAACCTGCGGTCTGTGA AGG (reversed) Intergenic
No off target data available for this crispr