ID: 935676319

View in Genome Browser
Species Human (GRCh38)
Location 2:105597671-105597693
Sequence TTGTTAGTCCTCAATTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935676319_935676324 18 Left 935676319 2:105597671-105597693 CCCTCCAAATTGAGGACTAACAA No data
Right 935676324 2:105597712-105597734 AAAAAGCCCCAAGAGCAGCATGG No data
935676319_935676322 -9 Left 935676319 2:105597671-105597693 CCCTCCAAATTGAGGACTAACAA No data
Right 935676322 2:105597685-105597707 GACTAACAAGAAAATGCAAGAGG No data
935676319_935676323 -6 Left 935676319 2:105597671-105597693 CCCTCCAAATTGAGGACTAACAA No data
Right 935676323 2:105597688-105597710 TAACAAGAAAATGCAAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935676319 Original CRISPR TTGTTAGTCCTCAATTTGGA GGG (reversed) Intergenic