ID: 935676323

View in Genome Browser
Species Human (GRCh38)
Location 2:105597688-105597710
Sequence TAACAAGAAAATGCAAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935676317_935676323 -4 Left 935676317 2:105597669-105597691 CCCCCTCCAAATTGAGGACTAAC No data
Right 935676323 2:105597688-105597710 TAACAAGAAAATGCAAGAGGAGG No data
935676321_935676323 -10 Left 935676321 2:105597675-105597697 CCAAATTGAGGACTAACAAGAAA No data
Right 935676323 2:105597688-105597710 TAACAAGAAAATGCAAGAGGAGG No data
935676316_935676323 0 Left 935676316 2:105597665-105597687 CCTGCCCCCTCCAAATTGAGGAC No data
Right 935676323 2:105597688-105597710 TAACAAGAAAATGCAAGAGGAGG No data
935676318_935676323 -5 Left 935676318 2:105597670-105597692 CCCCTCCAAATTGAGGACTAACA No data
Right 935676323 2:105597688-105597710 TAACAAGAAAATGCAAGAGGAGG No data
935676320_935676323 -7 Left 935676320 2:105597672-105597694 CCTCCAAATTGAGGACTAACAAG No data
Right 935676323 2:105597688-105597710 TAACAAGAAAATGCAAGAGGAGG No data
935676319_935676323 -6 Left 935676319 2:105597671-105597693 CCCTCCAAATTGAGGACTAACAA No data
Right 935676323 2:105597688-105597710 TAACAAGAAAATGCAAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935676323 Original CRISPR TAACAAGAAAATGCAAGAGG AGG Intergenic