ID: 935676324

View in Genome Browser
Species Human (GRCh38)
Location 2:105597712-105597734
Sequence AAAAAGCCCCAAGAGCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935676316_935676324 24 Left 935676316 2:105597665-105597687 CCTGCCCCCTCCAAATTGAGGAC No data
Right 935676324 2:105597712-105597734 AAAAAGCCCCAAGAGCAGCATGG No data
935676317_935676324 20 Left 935676317 2:105597669-105597691 CCCCCTCCAAATTGAGGACTAAC No data
Right 935676324 2:105597712-105597734 AAAAAGCCCCAAGAGCAGCATGG No data
935676319_935676324 18 Left 935676319 2:105597671-105597693 CCCTCCAAATTGAGGACTAACAA No data
Right 935676324 2:105597712-105597734 AAAAAGCCCCAAGAGCAGCATGG No data
935676321_935676324 14 Left 935676321 2:105597675-105597697 CCAAATTGAGGACTAACAAGAAA No data
Right 935676324 2:105597712-105597734 AAAAAGCCCCAAGAGCAGCATGG No data
935676320_935676324 17 Left 935676320 2:105597672-105597694 CCTCCAAATTGAGGACTAACAAG No data
Right 935676324 2:105597712-105597734 AAAAAGCCCCAAGAGCAGCATGG No data
935676318_935676324 19 Left 935676318 2:105597670-105597692 CCCCTCCAAATTGAGGACTAACA No data
Right 935676324 2:105597712-105597734 AAAAAGCCCCAAGAGCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935676324 Original CRISPR AAAAAGCCCCAAGAGCAGCA TGG Intergenic