ID: 935676403

View in Genome Browser
Species Human (GRCh38)
Location 2:105598229-105598251
Sequence ATTGGAAGCCACCAATGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935676395_935676403 29 Left 935676395 2:105598177-105598199 CCATTGCCAAAGTGAAAGCATAT No data
Right 935676403 2:105598229-105598251 ATTGGAAGCCACCAATGCGCAGG No data
935676400_935676403 4 Left 935676400 2:105598202-105598224 CCTGGGAGGAAGTGAAAGAATGA No data
Right 935676403 2:105598229-105598251 ATTGGAAGCCACCAATGCGCAGG No data
935676396_935676403 23 Left 935676396 2:105598183-105598205 CCAAAGTGAAAGCATATTGCCTG No data
Right 935676403 2:105598229-105598251 ATTGGAAGCCACCAATGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935676403 Original CRISPR ATTGGAAGCCACCAATGCGC AGG Intergenic
No off target data available for this crispr