ID: 935676867

View in Genome Browser
Species Human (GRCh38)
Location 2:105601914-105601936
Sequence GCGGTGTTTAAAAATCACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935676867_935676870 22 Left 935676867 2:105601914-105601936 CCAAGGTGATTTTTAAACACCGC No data
Right 935676870 2:105601959-105601981 TATCCAGCAATTGCACTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935676867 Original CRISPR GCGGTGTTTAAAAATCACCT TGG (reversed) Intergenic
No off target data available for this crispr