ID: 935676870

View in Genome Browser
Species Human (GRCh38)
Location 2:105601959-105601981
Sequence TATCCAGCAATTGCACTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935676867_935676870 22 Left 935676867 2:105601914-105601936 CCAAGGTGATTTTTAAACACCGC No data
Right 935676870 2:105601959-105601981 TATCCAGCAATTGCACTCTTTGG No data
935676869_935676870 0 Left 935676869 2:105601936-105601958 CCATTATTAAAAATTAAACTCTG No data
Right 935676870 2:105601959-105601981 TATCCAGCAATTGCACTCTTTGG No data
935676868_935676870 3 Left 935676868 2:105601933-105601955 CCGCCATTATTAAAAATTAAACT No data
Right 935676870 2:105601959-105601981 TATCCAGCAATTGCACTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935676870 Original CRISPR TATCCAGCAATTGCACTCTT TGG Intergenic
No off target data available for this crispr