ID: 935679054

View in Genome Browser
Species Human (GRCh38)
Location 2:105620336-105620358
Sequence GGGTAGGGATGCACCCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935679054_935679065 16 Left 935679054 2:105620336-105620358 CCTGGGGGGGTGCATCCCTACCC No data
Right 935679065 2:105620375-105620397 CAATGATGCACGTGCTTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935679054 Original CRISPR GGGTAGGGATGCACCCCCCC AGG (reversed) Intergenic
No off target data available for this crispr