ID: 935684294

View in Genome Browser
Species Human (GRCh38)
Location 2:105669933-105669955
Sequence CTGCTGCTCCTGGGCAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935684289_935684294 -3 Left 935684289 2:105669913-105669935 CCCAAGGCTGGGGCCATTGTCTG No data
Right 935684294 2:105669933-105669955 CTGCTGCTCCTGGGCAAAGCTGG No data
935684290_935684294 -4 Left 935684290 2:105669914-105669936 CCAAGGCTGGGGCCATTGTCTGC No data
Right 935684294 2:105669933-105669955 CTGCTGCTCCTGGGCAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935684294 Original CRISPR CTGCTGCTCCTGGGCAAAGC TGG Intergenic
No off target data available for this crispr