ID: 935688858

View in Genome Browser
Species Human (GRCh38)
Location 2:105712305-105712327
Sequence TGGCCACTGGAACCCCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935688858_935688872 22 Left 935688858 2:105712305-105712327 CCCCCTGGGGGTTCCAGTGGCCA No data
Right 935688872 2:105712350-105712372 AGATGATTCCCCTGTCAAGGGGG No data
935688858_935688863 -9 Left 935688858 2:105712305-105712327 CCCCCTGGGGGTTCCAGTGGCCA No data
Right 935688863 2:105712319-105712341 CAGTGGCCACCAAGTGTGAAAGG No data
935688858_935688871 21 Left 935688858 2:105712305-105712327 CCCCCTGGGGGTTCCAGTGGCCA No data
Right 935688871 2:105712349-105712371 GAGATGATTCCCCTGTCAAGGGG No data
935688858_935688865 -3 Left 935688858 2:105712305-105712327 CCCCCTGGGGGTTCCAGTGGCCA No data
Right 935688865 2:105712325-105712347 CCACCAAGTGTGAAAGGCCCTGG No data
935688858_935688870 20 Left 935688858 2:105712305-105712327 CCCCCTGGGGGTTCCAGTGGCCA No data
Right 935688870 2:105712348-105712370 AGAGATGATTCCCCTGTCAAGGG No data
935688858_935688869 19 Left 935688858 2:105712305-105712327 CCCCCTGGGGGTTCCAGTGGCCA No data
Right 935688869 2:105712347-105712369 GAGAGATGATTCCCCTGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935688858 Original CRISPR TGGCCACTGGAACCCCCAGG GGG (reversed) Intergenic
No off target data available for this crispr