ID: 935691751

View in Genome Browser
Species Human (GRCh38)
Location 2:105738169-105738191
Sequence AAGACTTCTAGCAGGAGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935691751_935691756 15 Left 935691751 2:105738169-105738191 CCACCGCTCCTGCTAGAAGTCTT No data
Right 935691756 2:105738207-105738229 CAAGTAAGCACTGAATGACTAGG No data
935691751_935691757 29 Left 935691751 2:105738169-105738191 CCACCGCTCCTGCTAGAAGTCTT No data
Right 935691757 2:105738221-105738243 ATGACTAGGCTGTAAGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935691751 Original CRISPR AAGACTTCTAGCAGGAGCGG TGG (reversed) Intergenic
No off target data available for this crispr