ID: 935691751 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:105738169-105738191 |
Sequence | AAGACTTCTAGCAGGAGCGG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
935691751_935691757 | 29 | Left | 935691751 | 2:105738169-105738191 | CCACCGCTCCTGCTAGAAGTCTT | No data | ||
Right | 935691757 | 2:105738221-105738243 | ATGACTAGGCTGTAAGTAACTGG | No data | ||||
935691751_935691756 | 15 | Left | 935691751 | 2:105738169-105738191 | CCACCGCTCCTGCTAGAAGTCTT | No data | ||
Right | 935691756 | 2:105738207-105738229 | CAAGTAAGCACTGAATGACTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
935691751 | Original CRISPR | AAGACTTCTAGCAGGAGCGG TGG (reversed) | Intergenic | ||