ID: 935691752

View in Genome Browser
Species Human (GRCh38)
Location 2:105738172-105738194
Sequence GGGAAGACTTCTAGCAGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935691752_935691756 12 Left 935691752 2:105738172-105738194 CCGCTCCTGCTAGAAGTCTTCCC No data
Right 935691756 2:105738207-105738229 CAAGTAAGCACTGAATGACTAGG No data
935691752_935691757 26 Left 935691752 2:105738172-105738194 CCGCTCCTGCTAGAAGTCTTCCC No data
Right 935691757 2:105738221-105738243 ATGACTAGGCTGTAAGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935691752 Original CRISPR GGGAAGACTTCTAGCAGGAG CGG (reversed) Intergenic
No off target data available for this crispr