ID: 935691753

View in Genome Browser
Species Human (GRCh38)
Location 2:105738177-105738199
Sequence TAAAAGGGAAGACTTCTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935691753_935691756 7 Left 935691753 2:105738177-105738199 CCTGCTAGAAGTCTTCCCTTTTA No data
Right 935691756 2:105738207-105738229 CAAGTAAGCACTGAATGACTAGG No data
935691753_935691757 21 Left 935691753 2:105738177-105738199 CCTGCTAGAAGTCTTCCCTTTTA No data
Right 935691757 2:105738221-105738243 ATGACTAGGCTGTAAGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935691753 Original CRISPR TAAAAGGGAAGACTTCTAGC AGG (reversed) Intergenic