ID: 935691754

View in Genome Browser
Species Human (GRCh38)
Location 2:105738192-105738214
Sequence CTTACTTGCATGTTTTAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935691754_935691757 6 Left 935691754 2:105738192-105738214 CCCTTTTAAAACATGCAAGTAAG No data
Right 935691757 2:105738221-105738243 ATGACTAGGCTGTAAGTAACTGG No data
935691754_935691758 22 Left 935691754 2:105738192-105738214 CCCTTTTAAAACATGCAAGTAAG No data
Right 935691758 2:105738237-105738259 TAACTGGAGCCCTCACTCAATGG No data
935691754_935691756 -8 Left 935691754 2:105738192-105738214 CCCTTTTAAAACATGCAAGTAAG No data
Right 935691756 2:105738207-105738229 CAAGTAAGCACTGAATGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935691754 Original CRISPR CTTACTTGCATGTTTTAAAA GGG (reversed) Intergenic
No off target data available for this crispr