ID: 935691756

View in Genome Browser
Species Human (GRCh38)
Location 2:105738207-105738229
Sequence CAAGTAAGCACTGAATGACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935691751_935691756 15 Left 935691751 2:105738169-105738191 CCACCGCTCCTGCTAGAAGTCTT No data
Right 935691756 2:105738207-105738229 CAAGTAAGCACTGAATGACTAGG No data
935691755_935691756 -9 Left 935691755 2:105738193-105738215 CCTTTTAAAACATGCAAGTAAGC No data
Right 935691756 2:105738207-105738229 CAAGTAAGCACTGAATGACTAGG No data
935691752_935691756 12 Left 935691752 2:105738172-105738194 CCGCTCCTGCTAGAAGTCTTCCC No data
Right 935691756 2:105738207-105738229 CAAGTAAGCACTGAATGACTAGG No data
935691754_935691756 -8 Left 935691754 2:105738192-105738214 CCCTTTTAAAACATGCAAGTAAG No data
Right 935691756 2:105738207-105738229 CAAGTAAGCACTGAATGACTAGG No data
935691753_935691756 7 Left 935691753 2:105738177-105738199 CCTGCTAGAAGTCTTCCCTTTTA No data
Right 935691756 2:105738207-105738229 CAAGTAAGCACTGAATGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935691756 Original CRISPR CAAGTAAGCACTGAATGACT AGG Intergenic